Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

2 years ago

What the temporal arch projects off of which bone to help form the cheek?

IRISSAK [1]

Zygomatic / Malar Bones

5 0

3 years ago

Read the Mungo Lady and Mungo Man Do others in the field of anthropology agree with Dr. Thorne's view? Explain.

sweet [91]

I've read the story back a couple months ago

Actually, there are many archeologists and anthropologists disagree with dr. Thorne's view. Basically, Thorne strongly believes that what many calls Homo erectus was, in fact, Homo sapiens, and that they migrated out of Africa almost 2 million years ago and dispersed throughout Europe and Asia. That would actually be very different from what scientists have always believed about the evolution of the species. That is why many of them are against him)

I hope I helped :)

5 0

2 years ago

Read 2 more answers