1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
11

Studies conducted in England during the industrial revolution have shown that children born to poor families were on average sho

rter than those born to wealthy parents. The most likely explanation for the difference in height is difference in
Biology
1 answer:
Pie3 years ago
6 0
<span>The answer is nutrition. Much like the difference between the height of people today and our grandparent's generation. Improved nutrition among wealthy families means that the bodies of the members of those families could reach their full potential height as limited by their genetics, and environmental factors did not come into play. In other words, the heights of poorer people are limited by both nurture and nature, whereas those of wealthyl people are limited only by nature.</span>
You might be interested in
Which is a correct statement about gametogenesis?
erica [24]

<span><span>In gametogenesis, germinal cells multiply by mitosis and mature gametes are formed by meiosis.

</span>Meiosis is the process of cell division by which involving gametes. Cell division is just the same for sperm and egg cells, but they have distinguishable descriptions and labels in the process. Spermatogenesis is for the males’ sperm cells and oogenesis is the process for females’ egg cells. The cell division of meiosis involves the two phases, respectively meiosis I and meiosis II. </span>Meiosis I like mitosis is the cell division that produces diploid cells<span>. These diploid cells are cells that contain a complete pair of chromosomes which is 46. The result is two diploid cells after the first meiosis. To provide clear explanation, in contrast haploid cells only contain 23 chromosomes and are created after meiosis II which is 4 in number.<span>
</span></span>

7 0
3 years ago
How is the circulatory system related to the digestive system??
Papessa [141]
The products of the digestive system are actually tied directly to the circulatory system in that the organs of the digestive system are used to turn ingested food into products that can be absorbed by the blood and then carried to other organs for use as energy or other functions.There are also several links between the digestive system and the respiratory system in that there are organs and muscles that serve both, for example the diaphragm which works to force air into and out of the lungs as well as to force waste products out of the digestive system.<span>All of the systems have to work together as well, without the intake of oxygen and exhalation of carbon dioxide, the function of the digestive system would grind to a halt.  Without the production of glycogen and other things necessary for muscular function, produced by the digestive system and then distributed by the circulatory system, all three functions would cease.</span>
3 0
3 years ago
The following events are part of endochondral ossification. In which order do they occur?
devlian [24]

The order is calcification of matrix  >> cells differentiate into osteoblasts >> formation of the primary ossification >>  osteoclasts break down the spongy bone >> formation of the secondary ossification (5,3,1,2,4). It is a fundamental process.

<h3>What are osteoblasts?</h3>

Osteoblasts are cells of the bones, which act to generate bone matrix and modulate the process of mineralization of the skeleton.

Endochondral ossification refers to the mechanism through which the cartilaginous bones generate longitudinal growth.

This mechanism (endochondral ossification) is fundamental during fetal/embryo development.

Learn more about endochondral ossification here:

brainly.com/question/5325975

5 0
1 year ago
Which microorganisms causes tooth decay?​
nadezda [96]

Answer:

Streptococcus mutans.

Explanation:

Streptococcus mutans is the bacteria (it is still a microorganism) that predominatly causes tooth decay. It is present in all areas of the mouth.

8 0
3 years ago
Can someone help me with these questions?
Black_prince [1.1K]

Answer: 3. adenine (A, green), thymine (T, red), cytosine (C, orange), and guanine (G, blue). 4. adenine (A), cytosine (C), and guanine (G) — are also found in DNA. 5. A nucleotide consists of a sugar molecule (either ribose in RNA or deoxyribose in DNA) attached to a phosphate group and a nitrogen-containing base. The bases used in DNA are adenine (A), cytosine (C), guanine (G), and thymine (T). 6.  food crops like soy and corn that have been genetically modified for pest and herbicide resistance. These crops are widely known as “GMOs” (genetically modified organisms). 7. There are two differences that distinguish DNA from RNA: (a) RNA contains the sugar ribose, while DNA contains the slightly different sugar deoxyribose (a type of ribose that lacks one oxygen atom), and (b) RNA has the nucleobase uracil while DNA contains thymine. brainliest?

Explanation:

8 0
2 years ago
Other questions:
  • Does mechanical waves travel faster or slower as density of matter increases
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Plz answer this question
    6·1 answer
  • A scientific theory _____.
    15·2 answers
  • 1. Why don't most people know how to start a fire without matches
    5·1 answer
  • A student makes the following list of facts about a groups of objects in space while watching a NASA documentary:
    7·1 answer
  • The O allele is unusually frequent in the Americas. What does this pattern suggest about the evolutionary history of these popul
    6·1 answer
  • What is the expected outcome of crossing two tomato plants that are heterozygous for hairy stems
    6·2 answers
  • What is the atomic mass/mass number of the atom in the diagram above.
    10·1 answer
  • What species originally eliminated the wolves in yellowstone so that they had to be reintroduced?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!