1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
9

Vascular plants transport nutrients through specialized structures called xylem and phloem. What is the purpose of the xylern?

Biology
1 answer:
katovenus [111]3 years ago
5 0

Answer:D

Explanation:

You might be interested in
Select the two major components of the blood.
Nadya [2.5K]

Answer:

Plasma and Platelets

Explanation:

These are the two main components that make up blood.

<h3 /><h3>hope this helps</h3>
7 0
3 years ago
Slate is a fairly common rock that can be used for roofing shingles. what property makes it most suitable for this use?
Lemur [1.5K]
The property that makes slate most suitable for roofing shingles is that it can be split into thin, flat layers.
This means that the roofs of houses and other buildings can be created from slate in order to cover the tops in the best way possible. Other materials are also often used for this purpose, but slate is one of the most popular ones nowadays because of that property it has.
6 0
3 years ago
One student did an experiment with sand, gravel, food coloring and water. The steps of the experiment are shown below.
EleoNora [17]
The experiments demonstrate the movement of pollutants through the ground water.

The sand and gravel make up the ground the water represents the ground water. The food coloring represents the pollutants.
4 0
3 years ago
Read 2 more answers
A chromosomal mutation is best described as —
abruzzese [7]

Answer:

Chromosome structure mutations are alterations that affect whole chromosomes and whole genes rather than just individual nucleotides. These mutations result from errors in cell division that cause a section of a chromosome to break off, be duplicated or move onto another chromosome.

Explanation:

7 0
3 years ago
HEALP PLEASE!!!!!
morpeh [17]

Answer:

hi here is your answer if it is wrong then sry

Explanation:

Flu vaccination is especially important for people 65 years and older because they are at high risk of developing serious complications from flu. Flu vaccines are updated each season as needed to keep up with changing viruses.

8 0
3 years ago
Other questions:
  • In an ecosystem, there are many factors that affect how many organisms can survive there. Which of the following is one of those
    7·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • following clear-cutting of a broadleaf forest several hundred years ago, the land was colonized by herbaceous species that were
    5·1 answer
  • Organisms reproduce in two different ways.What are they called and how do they differ?
    7·1 answer
  • TRUE or FALSE. | There is a gravitational attraction force between you and this computer.
    10·1 answer
  • Erosion is a destructive force that
    10·1 answer
  • A.) Give one example of how animals respond to their environment
    15·2 answers
  • Some people cannot digest milk products because they lack an enzyme to break down lactose in milk.
    8·1 answer
  • Which genetic disorder is this karyotype for?
    15·2 answers
  • Scientists use the scientific process to which mechanisms underlie observations; they do not if a particular finding is correct
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!