1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
15

Flowering plants are the most successful land plants. This is due, in part, to the trait that could be the label for point C. in

the cladogram. What trait is unique to this group of plants? A) vascular tissue B) perennial growth C) seeds protected in fruits D) alternation of generations
Biology
2 answers:
kogti [31]3 years ago
8 0

Answer:  c

Explanation:

Because Seeds in fruits are protected by the flower. But I don´t know if that´s the correct answer.

mario62 [17]3 years ago
6 0
Flowering plants are the most successful land plants because theri seeds are protected in fruits 
You might be interested in
.
horsena [70]

Answer:

C is correct ans

Explanation:

Mark my answer as brainliest and thank me

5 0
3 years ago
What are two internal factors that organisms respond to?
Amanda [17]
There are many internal factors which living organisms respond to, two of them are temperature and hormone levels. Organisms respond to internal factors in order to stay healthy and survive. The internal environment of living organisms has to be kept relatively constant, this is constancy is achieved through the process of homeostasis.
5 0
3 years ago
Read 2 more answers
Explain how biodiversity affects ecosystem services.
Kipish [7]

<h2>ecosystem services provided by biodiversity, such as nutrient cycling, carbon sequestration, pest regulation and pollination, sustain agricultural productivity. Climate change and other stresses have the potential to make major impacts on key functions, such as pollination and pest regulation services.</h2><h2 />
8 0
2 years ago
What type of monomers are combined to form carbohydrates?.
Illusion [34]
Saccharides are the monomers which are combined to form carbohydrates.

Depending on the type of carbohydrate, the monomer components can be monosaccharides, disaccharide, polysaccharide, etc.

E.g: Sucrose is a carbohydrate (specifically a dissacharide) that is made of glucose and fructose monosaccharides.

Another example is cellulose, which is a carbohydrate (specifically a polysaccharide) that is made of beta glucose monosaccharide components combined together.
3 0
2 years ago
What tiny blood vessels transports absorbed nutrients what is it called?
MAVERICK [17]

The tiny blood vessels that are responsible or have the role of transporting absorbed nutrients in our body is the capillaries. It is a network in which connects the venules and the arterioles in order to transport and connect nutrients for evenly distribution in the body.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Why are insects important for flowering the plants ?
    12·1 answer
  • Unlike other animals, mammals can perspire. The main benefit of perspiring is that it -
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How is variation introduced into populations of asexual organisms such as bacteria and amoebas?
    7·1 answer
  • Which statement is mostly likely to apply to a cell that has DNA within it cytoplasm
    6·1 answer
  • If sound doesn’t travel or move, then what does when we hear something that originated on the other side of the room?
    11·1 answer
  • Why would cells die if they were unable to make (or otherwise obtain) the amino acid arginine?
    10·1 answer
  • Whoever answers first and it's correct gets 30 points and the brainliest!
    5·2 answers
  • there are five different types of nucleotide bases found in living things. Which is an accurate comparison of the bases found in
    5·1 answer
  • Argentine ants are invasive ants found in California. They’re aggressive in nature and have a tendency to protect crop pests. In
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!