1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
3 years ago
8

1. How many grams are equivalent to 0.54 kilograms​

Biology
1 answer:
boyakko [2]3 years ago
6 0

Answer: 540 grams

Explanation: 0.54 kilograms x 1,000 grams per kilogram

You might be interested in
Which of the following describes something that oceanographers study?
mote1985 [20]

Answer:

ocean floor formation

Explanation:

3 0
2 years ago
HELPPPPPPPPPPPPPPPPPPP
maria [59]
One reason is for safety! in case you get stranded in a body of water you can keep yourself afloat
4 0
2 years ago
5. What is the difference between locomotion in plants and animals?<br>pls help he guyzzz ​
sp2606 [1]

Answer:

Animals can move, but plants cannot

Explanation:

Locomotion in humans and bipeds is accomplished through walking on legs. In other animals, it can be accomplished through walking on four limbs, flying, or swimming. In cells, cilia and flagella are used to move about. However, since plants are not capable of moving themselves, there is no locomotion of plant species.

4 0
2 years ago
What’s the answer to 17,18,19 please
STALIN [3.7K]

17. false

18. d

19. true

5 0
2 years ago
Darwin was curious about the distribution of living things which is the study of
kati45 [8]
The distribution of living things is biogeography. bio means living and geography means location
8 0
3 years ago
Read 2 more answers
Other questions:
  • Think about the dna coding sequence of a gene. if an a were swapped for a t, what kind of mutation could it cause and why? think
    11·1 answer
  • Gypsum and quartz can look very similar. which test can help you distinguish them?
    10·1 answer
  • Demyelination results from issues associated with myelin producing cells. What is an example of a myelin producing cell in the c
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Meiosis 1 begins with a?
    7·1 answer
  • Which chromosomal event in meiosis explains mendel's principle of independent assortment?
    7·1 answer
  • Sea otters use stones and rocks to break open abalone shells in order to eat the flesh inside. a young sea otter observes other
    14·1 answer
  • Which words or phrases describe slate? Check all that apply. Foliated igneous metamorphic does not split into layers grains arra
    5·1 answer
  • Plants have mitochondria and can preform cellular respiration. When would plants need to release energy by cellular respiration?
    12·1 answer
  • State at least <br>5 importance of soil to agricultural​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!