1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
finlep [7]
3 years ago
12

The planet Venus has a large amount of water vapor in its atmosphere, and like Earth, has experienced extensive volcanic activit

y throughout its history. Does this finding prevent the outside-in model from becoming a theory? Why or why not?
Yes, because Venus is near Earth and was likely affected by the same comets.
Yes, because it shows that volcanic activity is necessary for a planet to have water.
No, because data taken on Venus is not applicable to ocean formation theory on Earth.
No, because a single observation on one planet is not sufficient to discredit a theory.
Biology
2 answers:
Molodets [167]3 years ago
4 0

Answer: Option (4)

Explanation: In order to be a theory, a hypothesis or a model has to be able to prove the required necessary conditions and also it should be explainable.

The observations that were made initially, by studying about Venus was not sufficient enough to consider it to be a theory. Some additional evidences must be put forward in support of the observation. In doing this, different data are obtained which may sometime show error, leading to the failure of the experiment. So the evidences and the experiments must be correct enough to get the correct data.

It cannot considered to be a theory by making just a few observations. In the recent years, a lot of experiments, tests has been carried out regarding Venus and therefore were able to prove it as theory.

Thus, the correct answer is option (4).

galina1969 [7]3 years ago
3 0
No, because a single observation on one planet is not sufficient to discredit a theory.
There are too much variables that would cause that data, and just observing one planet is the same as ignoring all the potential variables.
You might be interested in
Existe relación entre el número de cromosomas y el número de genes en una especie?​
svetoff [14.1K]

Answer:

Chromosomes are structures within cells that contain a person's genes. Genes are contained in chromosomes, which are in the cell nucleus.

Explanation:

there is nothing that increased number of chromosomes mean more gene.

6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
हेटेरोसिस्ट से क्या आशयहै?<br>​
hjlf

Answer:

Give more detail please

Explanation:

5 0
3 years ago
Read 2 more answers
Which of the following statements best describes the function of a cell membrane?
Stels [109]
A is the correct answer
3 0
4 years ago
Rabbits are very popular domesticated animals, so popular that there are over 300 breeds of domesticated rabbits in the world. Y
Inessa [10]

Answer:

breed a has an average of 9 pounds

breed b has an average of 12.125 or 12 (rounded) pounds

Factors you may describe could be, food sources, environment, and climate could have changes in the characteristics of different breeds.

Having controlled factors, having 2 baby rabbits of the same breeds and monitoring the same food and water, observations and data can be collected, done multiple times data can be complied and used to theorize

6 0
3 years ago
Other questions:
  • Since hemoglobin is attracted more to carbon monoxide than it is to oxygen, what is likely to happen to a person if he breathes
    6·2 answers
  • Inside the cells of a leaf photosynthesis occurs. specifically, it takes place in the chloroplast of the leaf cell. when solar e
    6·1 answer
  • Jessica is traveling from Chicago, Illinois, to Miami, Florida. Using the map, tell what will happen to the land as she travels
    15·2 answers
  • Weathering can be either a chemical or a physical process. The action of water causes physical weathering of rock. Which example
    15·1 answer
  • What four kingdoms are in the domain eukarya
    8·2 answers
  • Eggs and sperm are examples of _____?
    14·1 answer
  • Use your codon chart and tell me what amino acids are coded for by the mRNA sequence AUG CGG UCC GGA
    5·1 answer
  • What would be the effect of losing just one of these nutrient cycles on Earth?​ please hurry
    10·1 answer
  • HELP PLEASE THIS IS DUE TODAY.<br> BIOLOGY
    9·1 answer
  • Predict the effect of an alternation in the sequence of nucleotide in the -35 region of a bacterial promoter​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!