1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igor_vitrenko [27]
3 years ago
14

Mitosis occurs in a body cell which is a 2. that undergoes one cell division forming two diploid cells having the same number of

chromosomes as the original cell.
Biology
1 answer:
TiliK225 [7]3 years ago
7 0
<span>Body cell
Diploid
One cell division
Two diploid cells
Same
Chromosomes </span>
You might be interested in
Describe how seeds are adopted for dispersal
Ket [755]

Answer:

Seeds disperse in four main ways, by air, water, animals and self propulsion:

Wind dispersal. Wind can carry seeds away from their parent plant.

Water dispersal. A few species use water to disperse their seeds.

Animal dispersal. Animals find fruits a rich source of food and as a result aid seed dispersal.

Explosion.

Explanation:

3 0
2 years ago
how energy transformations involved in photosynthesis are related to energy transformation involved in cellular respiration
Ad libitum [116K]

Answer:

Photosynthesis is the process by which energy is converted to chemical energy in plant cells. In cellular respiration plants use the chemical energy stored during photosynthesis in basic life processes. During both photosynthesis and cellular respiration, energy is converted.

Explanation:

MARK AS BRAINLIEST!!

6 0
2 years ago
Which land biome has the greatest diversity of plant species and which has the least?
cluponka [151]
<span>The tundra biome is the least diverse in terms of plant species of all land biomes. The rainforest is the most diverse in terms of plane species of all land biomes.</span>
6 0
2 years ago
Read 2 more answers
Which of the following statements about osmosis is correct?
Pavlova-9 [17]

Answer:

D. The presence of aquaporins (proteins that form water channels in the membrane) should speed up the process of osmosis.

Explanation:

Water moves in the cells through osmosis which means water moves from its higher concentration to lower concentration. In many animals and plants, water channels are also present which is called aquaporins which allow the water to move through it in and out of cell more quickly.

The rate of diffusion by channel proteins is higher than simple diffusion therefore the aquaporins speed up the process of osmosis. No ATP is required to transport the water through aquaporin channel proteins.

5 0
3 years ago
What would be the most likely result if humans stopped burning fossil fuels?
Vitek1552 [10]

Answer:

Explanation:

Even if we stopped burning fossil fuels, the Earth would continue warming up for another few decades because of all the heat we've already produced. Global temperatures would climb – finally stabilizing at a level much higher than we've ever known.

3 0
2 years ago
Other questions:
  • Match to show the differences between monocots and dicots.
    8·1 answer
  • What is the difference between cell differentiation and cell specialization
    8·1 answer
  • The disappearance of many species during a relatively short time is known as
    9·2 answers
  • People with lactose intolerance do not have enough ________.
    8·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How to summarize paragraphs
    12·2 answers
  • Which kind of molecule passes through the lipid bilayer of the cell membrane?
    12·2 answers
  • PLEASE HELP<br> will mark brainliest<br><br> Make a food chain using the following organisms
    6·1 answer
  • The smallest difference between two stimuli that can be detected is called
    10·1 answer
  • Need help ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Still have more work to do please help!!!!!!!!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!