1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
2 years ago
6

Nadph is essential for fatty acid synthesis and can be generated by which two enzymes?

Biology
1 answer:
sashaice [31]2 years ago
6 0

The two enzymes that help in the generation of NADPH which is essential for fatty acid synthesis are the Glucose-6-phosphate-dehydrogenase(G6PDH) and the Malic enzyme.

NADPH is predominantly produced by the pentose phosphate pathway, either directly by the malic enzyme as it oxidized malate to pyruvate or indirectly through the glucose-6-phosphate dehydrogenase.

NADP+ is used to make NADPH. The pentose phosphate pathway, which is catalyzed in the first stage by glucose-6-phosphate dehydrogenase (G6PDH), is the main source of NADPH in mammals and other non-photosynthetic organisms.

From glucose, the pentose phosphate pathway also generates pentose, a crucial component of NAD(P)H.

However, the Entner-Doudoroff route is also used by some bacteria, and NADPH generation is unaffected.

Learn more about NADPH here brainly.com/question/14870384

#SPJ4

You might be interested in
What part of a plant cell has the function of producing sugar in the presence of sunlight??
il63 [147K]
It's the <span>chloroplast.

Hope this helps !

Photon</span>
6 0
4 years ago
Read 2 more answers
Evaluate whether a sea beeze could occur night
Natalija [7]

Answer:

During the night the water releases it's heat much slower causing the air over the water to be warmer than the air over the land. This ends up working the same as the sea breeze only this time the lower pressure is over the sea and the air then moves from the land.

5 0
2 years ago
Read 2 more answers
Treatment of dividing cells with a low dose of the antifungal drug benomyl, which destabilizes microtubules, slows down correct
lilavasa [31]

Answer:

The answer is letter A.

Explanation:

A loss-of-function mutant in the gene encoding Mad2.

3 0
3 years ago
Hello can you answer this question? Why is language one of the most influential legacies a culture or civilization can leave beh
yanalaym [24]

Answer:

The legacy of the Roman Empire has been varied and significant, comparable to that of other ... One main legacy is the Latin language of ancient Rome

Explanation:???

4 0
3 years ago
Ap bio definition of primary productivity
diamong [38]
Mammals reproduce to the race
8 0
3 years ago
Other questions:
  • The diagram shows the general structure of a lipid, which consists of two main parts. Which part is circled?
    15·2 answers
  • What is the 4 classes of macromolecules
    8·1 answer
  • The atomic number of an element is always the same as _____. the number of electrons the number of protons the number of neutron
    13·2 answers
  • How does the polygastric digestive system aid in digesting roughage?
    14·1 answer
  • Which best explains how the body maintains homeostais?
    11·2 answers
  • What are the three types of environments cells are found in?
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Some plants respond to an external stimulus - such as
    6·2 answers
  • Use the table below to answer this questions ​
    12·1 answer
  • How dose a warm front form?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!