Why would a compound that interferes with bacterial cell wall synthesis be useful for treating a bacterial infection?

1 answer:

7 0

<span>If a compound could interfere with bacterial cell wall synthesis, it would destroy the cell. The bacteria would not survive failure of the cell wall. This compound would be useful in the treatment of bacterial infection as it would destroy the infection on a cellular level.</span>

You might be interested in

Bears and coyotes both consume large plant-eating mammals such as deer. When the deer are in short supply, bears and coyotes may

Gnesinka [82]

This is competition among predators.

8 0

2 years ago

Lead emissions since the early 1980s have

frez [133]

Lead emission since early 1980s have DECREASE DUE TO LEAD FREE GASOLINE.
Lead is a natural occurring element that is found in small quantity in rocks and soils. Lead emission is an important environmental health issue because a very small quantity of lead can cause adverse effects on the nervous system of unborn babies and young children. Because of this, the government took all necessary measures to ensure that its emission was drastically reduced.

4 0

3 years ago

Write the names of all the six nutrients mentioned in the text?

Nuetrik [128]

Vitamins, minerals, fibre, protein, carbohydrates, fats lipids

5 0

2 years ago

Progression through the cell cycle requires a cyclin to bind to a cdk because __________.

Studentka2010 [4]

Is there multiple choices?

6 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

2 years ago