1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
3 years ago
10

Which of the following devices is used to determine if an item is horizontal?​

Biology
1 answer:
DochEvi [55]3 years ago
4 0

Answer:

a level

Explanation:

it determines if its flat

You might be interested in
Which of the following pairs is mismatched? Select one: a. endoderm - bone b. mesoderm - muscle c. ectoderm - skin d. neuroectod
HACTEHA [7]

Answer: a. endoderm-bone

Explanation: In the context of embryonic development, bone tissue may arise from several precursor cell populations, such as the neural crest (some facial bones), lateral mesoderm (bones of the limbs, among others), and paraxial mesoderm (vertebrae and part of the skull). There is no evidence to suggest that any of the bony structures is derived from the endoderm germ layer.

8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Describe the effect of land development on biodiversity?
Leviafan [203]

Explanation:

  • The effect of land development on biodiversity has resulted in the habitat destroyed, the ecosystem is destroyed, species extinctions, and overexploited.
  • An increase in urbanization, human activities is the main cause of land development and this has affected biodiversity.
  • development in land includes activities such as clearing of land, increasing the intensity of a landscape, removal of vegetation, filling of the land, grading, construction, dredging has resulted in the loss of wildlife, affected the biota, threatened the ecosystems, species.
3 0
4 years ago
When cells were first taken from henrietta lacks, she was _____.?
Vsevolod [243]
<span>When cells were first taken from Henrietta Lacks, she was suffering from cervix cancer. Henrietta Lacks was a woman whose cervix cancer cells were used as the source of the HeLa cell line nowadays used in medical research. During treatment for cervical cancer in 1951, the cells were taken without her knowledge. The cells were cultured by George Otto Gey who created the HeLa cell line.</span>
8 0
3 years ago
If a mutation occurs such that photosystem ii no longer functions as efficiently as it should, what might be most directly affec
ivolga24 [154]

Out of the following given choices;

a) The amount of oxygen produced

b) The rate of ATP synthesis by ATP synthase in the chloroplast

c) The rate at which NADPH is produced

d) The rate at which the protons are transported into the thylakoid

The answer is; A

The photosystem captures energy from sunlight and uses it to split a water molecule.   After splitting the water molecule (by taking an electron), the protein complex transports the electron to plastoquinone. The splitting of water molecules results in evolving of oxygen molecules. The hydrogen is what is used to reduce carbon dioxide to glucose.


5 0
3 years ago
Read 2 more answers
Other questions:
  • Imagine that there are twenty-five different species of protists living in a tide pool. some of these species reproduce both sex
    11·1 answer
  • What is the consequences of the red blood cell being anucleate?
    8·2 answers
  • 1.Which term describes the amount of salt in an aquatic biome?
    10·2 answers
  • Within the cardiovascular system what is compered to the branches of a tree?
    5·1 answer
  • What is created between 2 amino acids during translation? O DNA polymerase peptide bond Ohydrogen bond RNA polymerase​
    13·1 answer
  • Adding all the three primary colors-red, green, and blue-at maximum intensity produces the color _____, while adding any two of
    5·1 answer
  • The stretch reflex in a skeletal muscle is initiated because of nerve impulses arising from an organ embedded in the muscle call
    12·1 answer
  • How is photosynthesis and cellular respiration cyclical ​
    8·1 answer
  • What is prokaryote and eukaryote? give there characteristic .
    6·1 answer
  • Assertion: Gene mutation is the basis of evolutionary genetic change.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!