1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nesterboy [21]
4 years ago
5

In fruit flies the traits for a yellow body and white eyes are always inherited together which conclusion can be drawn from this

phenomenon?
A. Both traits are dominant

B. The species has only one allele for each trait

C. The traits are controlled by one gene

D.The jeans for the trait are adjacent in the genome
Biology
1 answer:
nalin [4]4 years ago
6 0
The answer to this question would be that both traits would be dominant, allowing both traits to always be inherited together in a Punnet Square
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
How are sharks different form fish?
Marizza181 [45]

Answer:

A shark's skeleton is made of cartilage , a type of strong but flexible tissue .Most other fish are covered in smooth , flat scales . A shark is covered in sharp , toothlike scales called denticles . Most other fish have flaps over their gills.

Explanation:

I hope it's help yu and plz mark me brainliest........... plz plz plz

6 0
3 years ago
Read 2 more answers
Can someone help me with this please
marysya [2.9K]
The correct option is B. 80% of the radioactive phosphorus used in the experiment entered the cell showing that DNA was the hereditary material.
3 0
4 years ago
The particles that are found in the nucleus of an atom are
grigory [225]
The answer is C I believe
7 0
3 years ago
Giardia does it lead to elevated levels of IgE and eosinophilia?
vaieri [72.5K]

Answer:

No, Giardia is a protozoan that does not cause eosinophilia.

Explanation:

Eosinophilia refers to an increase in the number of eosinophils in the blood. The eosinophil is one of the white blood cells. When this occurs, the circulating eosinophils might be over 400 or 500.

Many factors might cause. One of them is parasite infections, in which helminths trigger the IgE generation, producing eosinophilia.

In the presence of the parasite antigen, eosinophils have a shorter medullar generation time, and they express a higher number of receptors for IgE and IgG. Their function is to damage the parasite, directly or indirectly, and to decrease the damages caused by their presence.

Giardia, among other protozoans, does not cause eosinophilia. Yet some other protozoans and parasites might induce it.

4 0
3 years ago
Other questions:
  • Maria bought a 1.75-pound package of turkey at a cost of $3.90 per pound. How much did Maria spend?
    7·1 answer
  • The three stages of cellular respiration are glycolysis, Krebs cycle, and the electron transport chain. When do cells exhibit al
    14·1 answer
  • For which codon(s) of isoleucine could a single base change account for an amino acid change to methionine?A. AUC B. AUU C. AUA
    12·1 answer
  • Which of the following organelles are only found in plant cells and not in animal cells?
    8·1 answer
  • The African plate is moving toward the eurasian plate at a rate of a few centimeters per year how will this era change in 100 mi
    7·1 answer
  • How many copies of a dna molecule result from two replications of a single dna molecule?
    8·1 answer
  • What is the primary difference between a hypothesis and a theory?
    8·2 answers
  • The macula densa cells respond to ________. the macula densa cells respond to ________. changes in na+ content of the filtrate a
    11·1 answer
  • Write three sentences that help explain why the frequencies of tusklessness in male and female tend to differ. Each sentence sho
    13·1 answer
  • The correct sequence for the five phases in the systems development life cycle (sdlc) process is?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!