Nitric oxide is a paracrine signal molecule because NO

Biology

1 answer:

hichkok12 [17]3 years ago

8 0

Answer:

C. is unstable, with a short half life

Explanation:

Paracrine hormones are the hormones that act on neighboring cells only. These hormones or chemicals are largely unstable and have a brief life as do not visit the distantly placed target cells. For instance, somatostatin is secreted by D cells of the pancreas. It acts in a paracrine manner and inhibits the discharge of hormones from the neighboring beta and alpha cell.

Likewise, one of the functions of unstable NO gas is to serve as a vasodilator. It is released by epithelium cells and serves to dilate arterioles and relax precapillary sphincters. Then it is degraded.

You might be interested in

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0

2 years ago

Is a cell membrane more like a brick wall or a chain-link fence? Why?

RideAnS [48]

Answer:chain-link fence

Explanation:a cell membrane is partial permeable which means that it lets some substances through but not other.

8 0

3 years ago

Read 2 more answers

What are the ecological impacts of wetland regions?

Karo-lina-s [1.5K]

I and IIIiiiiiiiiiiiiiiiiiiiii

3 0

3 years ago

Read 2 more answers

Give an example and description of the word Cycadophyta.

suter [353]

A cycadophyta is a biological dividsion, and within this,nthree are three families, and these are; Cycaclaceae, Strangeriaceae and Zamiceae. The plants of these are seed plants, which generally have characteristics, such as a stout, short and tough trunk made of wood, with a crown like span of evergreen leaves, with a cone shape protruding from the centre of the tree. Sorry, I wasnt able to attach an image, but if you google cycadophyta, this is what they look like. Sorry for the inconvenience, hope this helps

6 0

3 years ago

Why does each offspring get 2 alleles for a trait?

balu736 [363]

During meiosis, chromosome pairs are split apart and distributed into cells called gametes. Each gamete contains a single copy of every chromosome, and each chromosome contains one allele for every gene. Therefore, each allele for a given gene is packaged into a separate gamete.

4 0

2 years ago