1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lerok [7]
3 years ago
10

Nitric oxide is a paracrine signal molecule because NO

Biology
1 answer:
hichkok12 [17]3 years ago
8 0

Answer:

C. is unstable, with a short half life

Explanation:

Paracrine hormones are the hormones that act on neighboring cells only. These hormones or chemicals are largely unstable and have a brief life as do not visit the distantly placed target cells. For instance, somatostatin is secreted by D cells of the pancreas. It acts in a paracrine manner and inhibits the discharge of hormones from the neighboring beta and alpha cell.

Likewise, one of the functions of unstable NO gas is to serve as a vasodilator. It is released by epithelium cells and serves to dilate arterioles and relax precapillary sphincters. Then it is degraded.

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Is a cell membrane more like a brick wall or a chain-link fence? Why?
RideAnS [48]

Answer:chain-link fence

Explanation:a cell membrane is partial permeable which means that it lets some substances through but not other.

8 0
3 years ago
Read 2 more answers
What are the ecological impacts of wetland regions?
Karo-lina-s [1.5K]
I and IIIiiiiiiiiiiiiiiiiiiiii
3 0
3 years ago
Read 2 more answers
Give an example and description of the word Cycadophyta.
suter [353]
A cycadophyta is a biological dividsion, and within this,nthree are three families, and these are; Cycaclaceae, Strangeriaceae and Zamiceae. The plants of these are seed plants, which generally have characteristics, such as a stout, short and tough trunk made of wood, with a crown like span of evergreen leaves, with a cone shape protruding from the centre of the tree. Sorry, I wasnt able to attach an image, but if you google cycadophyta, this is what they look like. Sorry for the inconvenience, hope this helps
6 0
3 years ago
Why does each offspring get 2 alleles for a trait?
balu736 [363]
  • During meiosis, chromosome pairs are split apart and distributed into cells called gametes. Each gamete contains a single copy of every chromosome, and each chromosome contains one allele for every gene. Therefore, each allele for a given gene is packaged into a separate gamete.
4 0
2 years ago
Other questions:
  • Health-insurance companies could potentially use genetic information for client discrimination if it were made publically availa
    9·2 answers
  • PLS HELP ASAP WILL MAKE BRAINLIEST what are scientists going to study next on Kepler-186f?
    8·1 answer
  • How do enzymes play a role in living things, and what affects their function?
    13·1 answer
  • Describe the scientific evidence supporting the idea that all life has evolved from a common ancestor. Include a little bit abou
    13·1 answer
  • The plaque (microbial biofilm) that forms between your teeth is a highly anaerobic (oxygen-free) environment, even though the mo
    6·1 answer
  • Osmosis, or the movement of water into and out of a cell, is directly related to the concentration gradient on both sides of the
    7·2 answers
  • PLZ ANSWER ASAP GIVING BRAINLIEST
    7·2 answers
  • Eukaryotes have three nuclear RNA polymerases. The primary function of RNA polymerase II is transcription of _____.
    6·1 answer
  • Pls help <br> Give brainless <br><br> Discuss three implications of heart attack for the person
    15·1 answer
  • PLEASE HELP WITH THIS ONE QUESTION
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!