1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lerok [7]
3 years ago
10

Nitric oxide is a paracrine signal molecule because NO

Biology
1 answer:
hichkok12 [17]3 years ago
8 0

Answer:

C. is unstable, with a short half life

Explanation:

Paracrine hormones are the hormones that act on neighboring cells only. These hormones or chemicals are largely unstable and have a brief life as do not visit the distantly placed target cells. For instance, somatostatin is secreted by D cells of the pancreas. It acts in a paracrine manner and inhibits the discharge of hormones from the neighboring beta and alpha cell.

Likewise, one of the functions of unstable NO gas is to serve as a vasodilator. It is released by epithelium cells and serves to dilate arterioles and relax precapillary sphincters. Then it is degraded.

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
F(x) = x^2-5<br> g(x) = 4x - 4<br> Find (f-g) (5)
7nadin3 [17]

Answer

(f-g) (5) = 4

Explanation:

f(x) = x^2-5

g(x) = 4x - 4

Find (f-g) (5)

= (x^2-5)  - (4x - 4 )

= (5^2-5)  - (4(5) - 4 )

= 20 - 16

= 4

5 0
3 years ago
Read 2 more answers
Compare and contrast kelp forests and coral reefs
Fynjy0 [20]
Both kelps and coral reefs are composed of algae that grow in the shallow parts of the ocean in warm and sunny waters. However, kelp forest grows in nutrient-rich waters while corals can develop in low nutrient waters.
Kelp forests are therefore common where warm and cold current meet in an up-welling. Coral reefs are borne of a symbiotic relationship between coral polyps and algae. The coral forms a rigid carbon skeleton of calcium carbonate while kelps are long flexible algae plants.
7 0
3 years ago
What is the usefulness of<br> categorizing Earth's history<br> into the geologic time scale?
Galina-37 [17]
Answer-
Found this quizlet with the answer hope it helped

8 0
3 years ago
What is stored in carbon bonds
chubhunter [2.5K]
<span>The correct answer is chemical covalent energy. This energy is stored and when the bonds break the energy is released. You also need energy to break them. The most common form is a single bond but there are examples where there are double and triple bonds when building various compounds.</span>
4 0
3 years ago
Other questions:
  • Summarize why the fish heart and circulatory system are considered important evolutionary changes
    7·1 answer
  • Mutations, often causing conditions like leukemia and lymphoma, are the result of a certain change in non-homologous chromosomes
    8·2 answers
  • Geysers, hot springs, and bubbling mud are landscape features that are produced by which source of energy?
    6·2 answers
  • How do plankton differ from nekton?
    8·1 answer
  • What is a particle with two or more atoms joined together
    7·1 answer
  • Plz help me <br> WILL GIVE BRAINLIEST
    8·1 answer
  • Which sentence correctly describes the relationship between chromosomes and genes?
    5·1 answer
  • List, in order, the tRNA anticodons that are complementary to the mRNA sequence <br> AUGCAUGCAAGUUAG
    7·1 answer
  • 30. The entire molecule shown in the diagram below is the building block for RNA and is called a(n)
    14·1 answer
  • . What is the benefit of using a scanning electron microscope versus a light microscope?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!