1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
15

The most common landscape forms in the dry western United States are the basin and range and the ________.

Geography
1 answer:
lara [203]3 years ago
3 0
The answer to this question is "mesa and scarp". The most common forms in the dry western of United States are the basin and the range and the "MESA" and "SCARP". This is very known and prominent in the United States.
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which of the following is a strategy for managing health risks associated with pesticides?
Fittoniya [83]
Answer is C, just took the test. :)
4 0
4 years ago
Read 2 more answers
THREE COUNTRIES I THINK WILL BE SIMILAR TO CANADA AND THREE COUNTRIES I WILL BE DIFFERENT TO CANADA
pshichka [43]
Similar
Australia, France, Britain
Different
China
Russia
Ukrain
5 0
3 years ago
Does stencil one overlap exactly with the original image in Question 1? Describe what you see. After the transformations are com
DiKsa [7]

Answer:

Yes, stencil one overlaps exactly with the original image. The original pattern is now hidden behind stencil one. Each point on stencil one corresponds with a point on the original image.

Explanation:

8 0
3 years ago
Read 2 more answers
Have you ever wondered what makes weather? What causes it to snow, rain, get cold, or hot? Weather is simply the state of the at
Nataly_w [17]

1. The weather is made out of the conditions in the atmosphere at a particular place at a particular time, or rather at the moment. There are lot of different weather conditions, and they all depend on lot of different factors in order to occur. In order to have snowfall, there has to be cold air masses that will encounter humid air masses along the way, freeze the water vapor and produce snow. The rainfall occurs if there are warm and humid air masses that encounter either cold air masses, or some high mountain, that will cause condensation, and thus rainfall. The weather tends to be cold when there is cold air masses moving or forming into an area, while the hot weather is a consequence of the hot and dry air masses that form over the continents.

2. The weather is very hard to predict, even on the short term. The problem with the prediction of the weather is that it changes very quickly, and the main reason for that is that it is influenced by numerous factors, all of which can contribute to sharp changes in the weather conditions. Some of the factors that influence the weather on Earth are the planet's inclination, the planet's spinning around its own axis, global wind patterns, ocean currents, topography of the area, formation and movement of the air masses etc.

3. The ozone layer is a layer into another layer, the stratosphere. The ozone layer is extremely important, as it has the property that enables it to absorb very big amount of the ultraviolet radiation from the Sun. This layer is actually crucial for the survival for pretty much all organisms on Earth, as it stops the ultraviolet radiation from frying them. The depletion of the ozone layer is a serious problem, as it will cause larger portion of the ultraviolet to get to the surface, which will cause serious damage to most of the living organisms, including the humans, and maybe even result in mass dying out of the species if the depletion becomes too big.

7 0
3 years ago
Other questions:
  • which climate zone is often found closest to the equator, experiences warm to hot weather all year around, and has no dry season
    7·2 answers
  • What is the only state that touches four of the five great lakes?
    12·1 answer
  • How Plate tectonics folds,lifts,bends and breaks parts of the earth surface?
    7·2 answers
  • What is the heliocentric theory?
    6·1 answer
  • Does the earth have an unlimited supply of magma?
    9·1 answer
  • What protects Earth from the solar wind?
    10·1 answer
  • The geographic theories of Burgess, Hoyt, and von Thunen help us study how __________ develop.
    8·2 answers
  • According to the chart below, what is the first year in
    10·1 answer
  • What is Geography is small words?
    10·2 answers
  • Brazil has over 5500 municipalities.<br><br> Question 3 options:<br> True<br> False
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!