Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer is C, just took the test. :)
Similar
Australia, France, Britain
Different
China
Russia
Ukrain
Answer:
Yes, stencil one overlaps exactly with the original image. The original pattern is now hidden behind stencil one. Each point on stencil one corresponds with a point on the original image.
Explanation:
1. The weather is made out of the conditions in the atmosphere at a particular place at a particular time, or rather at the moment. There are lot of different weather conditions, and they all depend on lot of different factors in order to occur. In order to have snowfall, there has to be cold air masses that will encounter humid air masses along the way, freeze the water vapor and produce snow. The rainfall occurs if there are warm and humid air masses that encounter either cold air masses, or some high mountain, that will cause condensation, and thus rainfall. The weather tends to be cold when there is cold air masses moving or forming into an area, while the hot weather is a consequence of the hot and dry air masses that form over the continents.
2. The weather is very hard to predict, even on the short term. The problem with the prediction of the weather is that it changes very quickly, and the main reason for that is that it is influenced by numerous factors, all of which can contribute to sharp changes in the weather conditions. Some of the factors that influence the weather on Earth are the planet's inclination, the planet's spinning around its own axis, global wind patterns, ocean currents, topography of the area, formation and movement of the air masses etc.
3. The ozone layer is a layer into another layer, the stratosphere. The ozone layer is extremely important, as it has the property that enables it to absorb very big amount of the ultraviolet radiation from the Sun. This layer is actually crucial for the survival for pretty much all organisms on Earth, as it stops the ultraviolet radiation from frying them. The depletion of the ozone layer is a serious problem, as it will cause larger portion of the ultraviolet to get to the surface, which will cause serious damage to most of the living organisms, including the humans, and maybe even result in mass dying out of the species if the depletion becomes too big.
