1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
9

Give an EXAMPLE of each (not the definition):

Biology
2 answers:
shepuryov [24]3 years ago
4 0
•Heterozygous- pea plants flowers
scZoUnD [109]3 years ago
3 0
  • heterozygous = sugar, water

You might be interested in
Which two earth layers are separated by the moho boundary?
Viefleur [7K]
The crust and mantle.
8 0
3 years ago
Mendel determined that for a given character(i.e. pea seed shape) an individual has two factors that these can exist in two form
lions [1.4K]

Answer:

a. different alleles of the seed shape gene.

Explanation:

Mendel crossed different varieties of pea plants and he observed how phenotypic traits passed to the progeny. From these experiments, Mendel formulated the 'First Law of Segregation', where he observed that traits may exist in pairs that segregate (separate) at meiosis. During meiosis, i.e., gamete formation, these two factors separate from each other, thereby each gamete has the same probability of receiving either factor. Nowadays, we know that these two factors represent two different gene variants or 'alleles' for a given gene <em>locus</em>. Alleles can be classified into dominant or recessive as in the example above described, where the R factor (round) dominates on the r factor (wrinkled) to determine the seed shape.

5 0
3 years ago
Which of the following is not an attitude that scientists need
frutty [35]
<span>Curiosity. Curiosity is a fundamental characteristic of a good scientist. ...Creativity. ...Accuracy of Observation. ...<span>Skepticism. 

but they dont need playing around not being skepticism.</span></span>
3 0
3 years ago
Read 2 more answers
Mycorrhizae is a mutualistic relationship between fungi and algae in which the algae takes advantage of the fungi.
SCORPION-xisa [38]
The answer to this question would be: False

The symbiotic between plant and fungus is called lichen. In this case, the Mycorrhizae having a mutualism symbiotic with algae as they are giving benefit to each other. The Mycorrhizae will give water and inorganic compound and the algae will give food. The answer is false because the algae are not parasitic to the fungi.
3 0
3 years ago
Viruses have all of the characteristics of living things except
Nezavi [6.7K]

Answer: I think its cells

Explanation:

Viruses dont have cells

6 0
2 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Researchers believe that _____ may be able to successfully treat previously incurable conditions such as paralysis and alzheimer
    12·1 answer
  • How are plants similar and different from animals?
    8·1 answer
  • Your friend is considering using steroids to increase muscle mass. you would warn him that steroid abuse can lead to
    14·2 answers
  • Which of the following is correct about the flatworm's muscular system ?
    5·2 answers
  • Hypothesis Practice which Oreo cookies filling do you think the class would like the best chocolate, vanilla creme or peanut but
    8·1 answer
  • All the living and nonliving things in a selected area form a (an)?​
    13·2 answers
  • I need help with all the questions and filling out the punnet square
    7·1 answer
  • What are 5 different kinds of proteins made by ribosomes?
    5·1 answer
  • What pressure, in atm, will be exerted by 8 moles of a gas at 300
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!