1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
9

Give an EXAMPLE of each (not the definition):

Biology
2 answers:
shepuryov [24]3 years ago
4 0
•Heterozygous- pea plants flowers
scZoUnD [109]3 years ago
3 0
  • heterozygous = sugar, water

You might be interested in
All of the following are examples of informational social influence except:
Cerrena [4.2K]

Answer:

c. when you get to college you change the way you dress so that you "fit in" better--that is, so that people will like you more.

Explanation:

Informational social influence leads to internalization (private acceptance) of the majority opinion/behaviour i-e you actually change your attitude / belief. It is basically a difficult task , unsure of the answer, usually ambiguous , actually use others's response to form an opinion and actually believe what others say and internalize in. It is usually found in the crisis situation, when you don't know what to do and following th advice of expert. Examples include listening to fireman.

Hence in the given options, only c. when you get to college you change the way you dress so that you "fit in" better--that is, so that people will like you more. seems not to be example of Informaltiona social influence.

3 0
3 years ago
Cancers are caused by two types of risk factors, those related to heredity and those that result from a person's
saw5 [17]
The other is a result of ones radiation or sun exposure
5 0
3 years ago
Read 2 more answers
During diffusion, molecules move
skad [1K]
Yes i bleve that during diffsion molicules move.

4 0
2 years ago
Read 2 more answers
WILL GIVE A BRAINLEST
Mariana [72]
<span>strip-cropping:cultivation of crops in strips following the contours of the land</span>
7 0
3 years ago
Read 2 more answers
Fill in the blank. In the -------- division of meiosis, chromatids split apart, becoming single chromosomes
Marina CMI [18]
Cell
i believe it is
6 0
3 years ago
Read 2 more answers
Other questions:
  • many times students stuggle whit rthe difference between the terms allele and gene . how would you explain the difference of the
    8·2 answers
  • . Many cities have “combined” sewers. In good weather, these systems funnel sewage to treatment plants. During rainstorms street
    6·2 answers
  • Where do the alleles contained in a zygote come from
    12·1 answer
  • Explain how the structure of an enzyme relates to how well the function catalyzes chemical reactions
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Can some one help me with this question pllllease ASAP
    6·2 answers
  • Why does sexual reproduction result in more genetic variation in a species?
    15·2 answers
  • How does groundwater become polluted?
    10·2 answers
  • Cellular respiration uses one molecule of glucose to produce a total of
    13·2 answers
  • Heat is necessary for water to: A- precipitate<br> B- condense <br> C -form dew <br> D- evaporate
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!