1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sphinxa [80]
3 years ago
14

In what part of a chloroplast does glucose production occur?

Biology
2 answers:
a_sh-v [17]3 years ago
8 0

Hello There!

The part of the chloroplast that glucose production occurs in is called

<u><em>"The Stroma"</em></u>

Flauer [41]3 years ago
8 0
The storms is where glucose production occur
You might be interested in
A neighbor is walking her dog to the park during her lunch break on a beautiful sunny day. explain how her skin is working to pr
MAVERICK [17]
<span>1. A neighbor is walking her dog to the park during her lunch break on a beautiful sunny day. explain how her skin is working to protect her from ultraviolet radiation due to intense sun exposure. be sure to discuss the specific structures and substances involved in this protection.

Ultraviolet light is dangerous as it could damage the skin. The skin will react by producing a dark granule called melanin which will absorb the light. Melanin is produced by the melanocyte in the epidermis. This will make the skin looks darker, especially people that frequently exposed to light.

2. mike is beginning his summer football camp today. the temperature high today is 85 degrees with moderate humidity. discuss two ways the skin's structures and functions are working to provide homeostasis and temperature regulation in this football player.

The sweat glands will produce sweat and sent it to the epidermis. This will make the epidermis wet. If the humidity is low, the water in epidermis will be evaporated and taking heat from the skin.
When the temperature is too high, the blood vessel in dermis part of the skin will dilate to make the body lose heat more.

3. this weekend you are going camping with your closest friends and family. thankfully, the layers of your skin will help protect you during this adventure. discuss at least two ways each layer, the epidermis and dermis, may protect you on this excursion.

When camping, you might need to interact with the wild plant directly. The epidermis is made of keratinized squamous cell that could protect the skin from any physical damage like a sharp branch. It also protects from bacteria and other microorganisms. 
Wilderness has a fluctuating temperature. The dermis has a fat that will help insulating heat when faced with a cold environment. It also has sweat glands to reduce body heat in the hot environment.</span>
5 0
4 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The macronutrients that we consume are broken down through digestion and then absorbed in order to ultimately. True or False
EastWind [94]

The question is incomplete as it is incomplete therefore a picture of the complete question has been attached.

Answer:

To be used by the cells for energy

Explanation:

The digestive process of humans digest or breakdown or oxidise the organic molecules present in the food to simple compounds which could be easily utilised by the human body.

The human body composed of tissue and cell requires energy to perform metabolic reactions in the form of ATP which are provided by the digestion of the complex food material.

The macronutrients present in the food thus are digested and absorbed by the cells to perform reactions which could provide energy therefore the selected option is the correct answer.

7 0
3 years ago
Why are DNA fingerprints are more reliable than hand fingerprints in solving crimes.
Harrizon [31]

Answer:

Fingerprints are still the most cost-effective and reliable way to identify people: ... No two fingerprints have ever been identical in the many millions of comparisons. Fingerprints solve ten times more unknown-suspect cases than DNA fingerprinting.

Explanation:

8 0
3 years ago
Read 2 more answers
A person with the early stages of osteoarthritis would experience which of the following problems?
son4ous [18]

Answer:

Option D

Explanation:

Osteoarthritis is the most widely recognized type of joint inflammation, influencing a large number of individuals around the world.  

It happens when the defensive ligament that pads Ends of the bones wears out after some time.  

Despite the fact that osteoarthritis can harm any joint, the disease most normally influences joints in the knees, hips, hands and spine.

The early stages of this disorder shows pain in joints, swelling, articular cartilage inflammation, flexibility loss, etc.

5 0
3 years ago
Other questions:
  • On the electromagnetic spectrum, infrared light has a lower frequency than visible light, which has a lower frequency than ultra
    6·1 answer
  • Which is one difference between the way terrestrial planets and Jovian planets formed?
    5·2 answers
  • What are the fingerlike projections of the small intestine that increase the absorptive surface area?
    9·1 answer
  • Mycelia produced in asexual reproduction are _____.
    10·1 answer
  • What describes the habitat of a frog
    14·2 answers
  • How is energy released from an ATP molecule ?
    9·1 answer
  • Based on the information in the graph, what conclusions can be drawn about the rate of skin cancer in men compared to that in wo
    7·2 answers
  • Which of the following punctuates dialogue properly
    10·1 answer
  • What gets created during respiration?​
    15·2 answers
  • What would happen if everyone ate raw food only?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!