1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
velikii [3]
3 years ago
12

What food did they eat at the first thanksgiving?

Biology
1 answer:
lesya [120]3 years ago
3 0
Wild animal meat (small game animals), various vegetables, (corn, squash, etc.)
You might be interested in
What kind of mutation would occur if a sequence of DNA is changed from ATCGGCTTAACG to ATCGGCTAAACG?
Zinaida [17]

Answer:

Base substitution mutation

Explanation:

Mutation is the alteration or change that occurs to the sequence of a gene caused by a mutagen (chemicals) or spontaneously-induced. Depending on how the mutation occurs, it is of different types. The mutation shown in this question is as follows:

ATCGGCTTAACG to ATCGGCTAAACG

This type of mutation is called SUBSTITUTION MUTATION. Substitution mutation is a type of mutation that involves the replacement of one or more nucleotide base by another. In this original sequence; ATCGGCTTAACG, the eight base T was replaced by base A in the sequence, hence, it is a substitution mutation.

4 0
3 years ago
What is a telomere? What happens to telomeres each time DNA is replicated? How do cells prevent this from occurring?
vredina [299]
Telomeres are protective sequences of nucleotides found at the ends of chromosomes,Which become shorter every time a cell divides.
A gradual degeneration of an organism occurs, resulting in ageing.
However, some cells are able to replenish their telomeres using the enzyme telomerase. 
Hope this helps! :)
7 0
3 years ago
This was a worldwide scientific project that deciphered the dna code of all the human chromosomes of the body
Flura [38]

The human genome project

5 0
3 years ago
HELP THIS IS TIMED!!!
faust18 [17]

Answer:

anatomy and neurobiology

Explanation:

Molecular Biology is the field of biology that studies the composition, structure and interactions of cellular molecules – such as nucleic acids and proteins – that carry out the biological processes essential for the cell's functions and maintenance.

<em>Successful molecular biologists have an excellent understanding of subjects such as cell physiology, chemistry, genetics, and physics.</em>

<em>A neuroscientist (or neurobiologist) is a scientist who has specialised knowledge in the field of neuroscience, the branch of biology that deals with the physiology, biochemistry, psychology, anatomy and molecular biology of neurons, neural circuits, and glial cells and especially their behavioral, biological, and psychological aspect in health and disease. </em>

8 0
3 years ago
Read 2 more answers
How are science and technology-related?<br> pls help me at least 1 sentence.
Vesna [10]
I honestly don’t get wht u mean
5 0
3 years ago
Read 2 more answers
Other questions:
  • the graph predicts the effect that each factor would have on the biodiversity of the mediterranean sea in the next 10 years. how
    14·2 answers
  • ______ are structures that allow for one-way blood flow through the heart.
    14·2 answers
  • In a classic experiment using pea shape
    8·1 answer
  • Imagine that you adapted to a motion stimulus with one eye and then switched to the other eye and did not experience a motion af
    8·1 answer
  • The type of cells that secrete directly into the blood stream are _______ cells.
    13·1 answer
  • Can someone help me with this?​
    9·1 answer
  • List 2 consumer - consumer relationships from the web.
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Two Changes that happen to your gas exchange system when you exercise regularly
    15·1 answer
  • The most common usable form of energy in a cell is
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!