1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
2 years ago
5

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first

C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Biology
1 answer:
Elden [556K]2 years ago
4 0

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

You might be interested in
Development and impact on desert areas is mainly due to Select one:
Eva8 [605]

Answer:

Answer is C. Modern irrigation.

Explanation:

The word 'irrigation ' means the process of supplying water or watering of land in preparation for planting and watering of planted crops to survive.

Modern irrigation involves the construction of hoses, channels and canals. This is done so that water will be available through out the seasons for the crops, and water will be supplied to areas where there is scarcity of water.

Irrigation is very important because it prevents famine, improves water condition in the soil by dissolving nutrients for plant use.

5 0
3 years ago
Carly has wavy hair. Her father has straight hair, and her mother has curly hair. Which type of inheritance pattern is responsib
igor_vitrenko [27]
Complete dominance  :)


7 0
3 years ago
Read 2 more answers
Which is a function and which isn't??? plz answer soon cause its due tomorrow
lora16 [44]
The answers i got are in blue, if one value of x has more than one value of y it is not a function, otherwise it is

5 0
2 years ago
Regulation of internal environment​
Svetlanka [38]

Answer:

The regulation of an internal environment is called homeostasis.

Explanation:

Homeostasis is when you can maintain a stable inner environment.

8 0
2 years ago
Read 2 more answers
Which of the following would be a good adaptation for an organism that lives in the intertidal zone?
barxatty [35]

The right answer is A.

The foreshore, also called intertidal zone, is the tidal zone of the tides on the coast. The alternation of the tides which discover more or less the substrate according to the phases of the Moon determines the conditions of humidity, salinity and temperature of the foreshore.

These variations lead to a vertical ecological structuring of the foreshore in so-called supralittoral, mediolittoral and infralittoral stages. The floristic and faunistic stands of these stages are distinct, according to the requirements of organisms in water, salinity and temperature. Therefore it would be beneficial for organisms living in this period that it can live without depending on the water present in their environment since the presence of the latter is inconstant.

The foreshore is divided into several floors that correspond to different ecological conditions. These coastal stages are defined by the duration of their emergence and therefore by the level of the different tides.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Living organisms break down polysaccharides into
    11·1 answer
  • If a contact downloads a piece of your content, such as a newsletter titled, "the best ways to create subject lines for email,"
    8·2 answers
  • True or False Diatoms arena type of protozoa.
    10·1 answer
  • Identify the organelles labeled
    13·1 answer
  • HELP ASAP!!!! I WILL GIVE BRAINLIEST!!!!!!!!!!!!
    6·1 answer
  • Match the following parts of a flower with their descriptions.
    12·1 answer
  • Which of the following is NOT a category that is used to describe soil?
    6·2 answers
  • When digested, proteins are broken down into _____. glycerol only fatty acids only monosaccharides amino acids both glycerol and
    14·1 answer
  • Essay about why people should not join a gang​
    15·1 answer
  • PLEASE ANSWER ASAP!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!