1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
3 years ago
5

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first

C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Biology
1 answer:
Elden [556K]3 years ago
4 0

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

You might be interested in
why is it impossible for hikers camping near the top of a 14000 foot peak to get a really hot cup if coffee
Law Incorporation [45]
Because the oxygen level is lower
3 0
4 years ago
In the cranes what does songsam recall in the two flashbacks to his childhood? explain how these memories motivate songsam's act
True [87]
The "Cranes" is a short story book written by Hwang Sunwon. The story is set in Korea during the Korean War and focuses on two childhood friends, Songsam and Tokchae, who are on opposite sides during the war. Songsam has two flashbacks of his childhood memories with his friend Tokchae, where he remembers how they used to climb the trees and catch cranes. These flashbacks act as a reminder of the times he had spent with his friend and the importance of this friendship. As a result, these memories motivate him to let Tokchae free.
5 0
3 years ago
Compare and contrast osmotic challenges faced by animals in freshwater, marine, and terrestrial environments, and the adaptation
Gnesinka [82]

Answer:

  • Fresh water fish have higher salt contents in their bodies than in their environments.
  • Marine fishes have less salt in their bodies than their environment
  • Terrestrial organisms have the challenge of water retention due to atmospheric contact.

Explanation:

FRESH WATER OSMOREGULATION

The salt concentration in salt water fish is higher than the concentration found in its environment (fresh water). This causes water to enter into the body of the fish through osmosis and without regulating processes, the fish is bound to swell and likely burst.To compensate for this challenge, the kidney in fresh water fish produces a large amount of urine, causing them to lose salt. To ensure too salt is not lost beyond the basic requirement, chloride cells in the gills take up ions from the water which are transported into the blood.

MARINE OSMOREGULATION

In marine fishes, the challenge opposes that of fresh water fishes since salt content in this case is lower in their blood than in their environment. To address this challenge, marine fishes lose water constantly while retaining salts to lead to a build up. The water lost, is then made up for and replenished by continual drinking of seawater. The chloride cells in marine fishes works in a manner opposing that of fresh water fish, functioning to compliment the excretion of salts by the kidney.

TERRESTRIAL OSMOREGULATION

The major challenge of osmoregulation in  terrestrial organisms is water regulation in the body owing to their contact with the atmosphere.

Terrestrial organisms possess effective kidneys which enable osmoregulation. A series of processes including filtration, re-absorption and tubular secretion, enable regulation of fluids and water conservation.

Water passes out of the descending limb of the loop of Henle, leaving a more concentrated filtrate inside. Salt diffuses out from the lower, thin part of the ascending limb. In the upper, thick part of the ascending limb, salt is then actively transported into the interstitial fluid. The amount of salt in the interstitial fluid, determines how much water moves out of the descending limb i.e the saltier it gets, the more water moves out of the descending limb. This process leaves a concentrated filtrate inside, so more salt passes out. Water from the collecting ducts moves out by osmosis into this hypertonic interstitial fluid and is carried away by capillaries, achieving osmoregulation.

8 0
3 years ago
Read 2 more answers
Which organism has a better chance of leaving a fossil a jellyfish or a bony fish?
lara [203]
<span>Fossils, or the fossilized remains of an animal, tend to be bones which are made of much denser materials than flesh. Since a jellyfish has no bones, a bony fish is more likely to leave a fossil.</span>
4 0
3 years ago
Which set of atoms can be found in all carbon based molecule
Allushta [10]

Answer:

Carbon Atoms

Explanation:

7 0
3 years ago
Other questions:
  • Use mathematical representations to trace the transfer of matter and energy from one organism to another.
    8·1 answer
  • The plant below is purebred for height tall. Write the alleles of this plant. In any cross for height, what kind of Offspring wi
    6·1 answer
  • Where do tigers and alligators live
    5·2 answers
  • Griffith called the process he observed transformation because
    14·2 answers
  • Why is the nucleus the most obvious organelle within a cell?
    7·1 answer
  • Compare and contrast the structure and function of a compound light microscope and a dissecting microscope. Be sure to discuss w
    5·1 answer
  • Somebody help me with these 4 questions please
    5·1 answer
  • A ______ is a type of turbine used to capture the energy of moving air. A. geotherm B. windmill C. solar panel D. dam
    11·1 answer
  • What basic substances make up a cell
    9·2 answers
  • ¿Cuales son las funciones vitales de la célula?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!