1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
3 years ago
5

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first

C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Biology
1 answer:
Elden [556K]3 years ago
4 0

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

You might be interested in
What is true concerning a quantitative trait? Multiple Choice Individuals fall into distinct classes for comparison The phenotyp
lana66690 [7]

Answer:

The phenotypic variation for the trait is continuous

Explanation:

Genetically speaking, quantitative traits are controlled by many genes, classes are not easily distinguishable and there is a continuous distribution of the phenotype. These characteristics refer to measurements of quantities (weights, volumes, measurements: kg, m, cm, g, m2, etc.).

In other words, quantitative characteristics are those that exhibit continuous variations and are partly of non-genetic origin; that is, they are greatly affected by the environment.

3 0
3 years ago
In an experiment, the presence of an____is manipulated by the researchers so that it affects may be determined
erica [24]

Answer: independent variable

Explanation:

3 0
3 years ago
Evolutionary theory contends that genetic ___________ is necessary and beneficial for humanity when there is an environmental ch
Anni [7]

Answer:

variation

Explanation:

Genetic variation is what makes us all unique as a result of subtle changes in our DNA.  The Theory of Evolution is a process in which organisms change over time as a result of adapting to their environment.  Charles Darwin came up with the term Survival of the fittest, in any environment plants and animals from the same species show natural variation in their physical characteristics, like neck lengths in giraffes.  Darwin suggested that the plants and animals best suited to the environment will survive and pass on their characteristics to their offspring. Over time, the characteristics of the surviving members of the species will become predominant.

Example: Peppered moth

In London in the 1800's, 98% of peppered moths had light colored bodies and only 2% were dark.  The light moths were the same color as the trees so they could easily hide from hungry birds and not get eaten.  The dark moths however were easy to see and were eaten.  Then came the factories and smoke of the industrial evolution and many trees turned black with soot and suddenly the dark moths were able to survive better as they now looked like the trees and the light colored moths were easier to spot and eat.  By 1895 the dark peppered moths made up 95% of the population and the light colored moths only 5%.  This is an example of natural selection, because of the gene that makes the moths dark, it allowed them to flourish when the environment changed, they adapted, reproduced and survived.

8 0
3 years ago
Which locations on the map are low-pressure areas?<br> A<br> B<br> C<br> D<br> E
klemol [59]

<em><u>PLATO ANSWER:</u></em><em> </em>A and C

Hope this helps, have a amazing day!

3 0
3 years ago
How hasn't cell technology most likely benefited the commercial flower industry
worty [1.4K]

chicken is really good

5 0
3 years ago
Other questions:
  • The dietary guidelines for americans promote a minimum of _____ minutes of moderate exercise weekly. 40 80 150 120
    11·2 answers
  • What was one characteristic of a New England colonial town?
    8·1 answer
  • What information does DNA provide to each of the cell's organelles?
    12·1 answer
  • In peas, the trait for tall plants is dominant (T) and the trait for short plants is recessive (t). The trait for yellow seed co
    9·1 answer
  • The and are part of the digestive system
    6·2 answers
  • Which is not a function of the plasma ​
    11·2 answers
  • How many times must a cell divide to create eight cells
    7·1 answer
  • How would the amount of available energy differ in the trophic level of the mouse compared to the trophic level of the hawk?
    10·1 answer
  • Which type of weather event forms over land when high-speed, rotating winds surround a region of extremel
    6·2 answers
  • What condition is required for piles of sediment to become a sedimentary rock?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!