1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
butalik [34]
3 years ago
10

Which of the following criteria do astronomers use to classify an object as a planet

Biology
2 answers:
Oksanka [162]3 years ago
6 0
Orbits a star gravity makes spherical at least as large as mercury clears orbits of other objects

Xelga [282]3 years ago
6 0
If it orbits a star, Or if its gravity makes is spherical. 
You might be interested in
Use the passage to answer the following question.
alekssr [168]
The answer is A, anti-fungal drugs.

According to the passage, "but if the problem persists, see a doctor who can prescribe anti-fungal drugs". In additional, at the beginning of the passage, it already stated that athlete's foot is caused by a fungus, so we can sure that the answer is A.
6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Consider a helminthic infection in which an individual is colonized by a parasitic worm. The worm is too big to be engulfed by a
Assoli18 [71]

Answer

The worm gets coated with antibodies, which activate other cells in the immune system to secrete chemicals that kill it.

Explanation:

Production of T-helper I cytokines like IFN gamma, IL-2 and IL-18 is highly protective against helminth infection by activating the macrophage intracellular killers. Protection against mucosal eosinophil responses in which antiparasitic chemicals are released. Killing also involves direct cytotoxic mechanisms in which T- cell and NK-cells directly release antiparasitic agents like perforin and granulysin which kill the parasite.

6 0
3 years ago
Variations of homologous genes that result in differences in structure and function are
damaskus [11]
Alleles. Alleles are the "same" genes, but provide a variation of the intended function. 
4 0
3 years ago
Read 2 more answers
The orange color of carrot roots and marigold flowers comes from cell bodies known as chromoplasts. True False
aliina [53]
<span>The question says,'the orange colour of carrot roots and marigold flowers comes from cell bodies known as chromoplasts. The statement is true. Chromoplasts are coloured plastids, they usually contain a yellow or orange pigment. They can be found in roots, leaves, fruits and ageing leaves and are responsible for the distinctive colours of these plant parts.</span>
3 0
3 years ago
Other questions:
  • Why do individual water masses within the oceans retain distinctive physical properties for long periods?
    15·1 answer
  • Please select the word from the list that best fits the definition
    10·2 answers
  • Which penguins don't migrate?
    13·2 answers
  • The table below shows the building blocks of the macromolecules. Which building blocks belong in the missing spots?
    9·2 answers
  • NEED A BIO EXPERT TO HELP ME WITH HW!!
    5·1 answer
  • Should I take biology or physics?
    13·2 answers
  • que cantidad de calor se debe aplicar a una barra de plata de 24kg para que eleve su temperatura de 20°C a 80°C​
    10·1 answer
  • some students used information they gathered from their investigations to prepare a table.they enter table in the lab notebooks.
    9·1 answer
  • What is the missing word? In mature animals, cell division is mainly restricted to repair and __________ of old cells
    12·2 answers
  • When designing your experiment, what would your experimental group and your independent variable be?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!