1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
14

This graph shows the variation in birth weights in a specific population of humans.

Biology
1 answer:
lorasvet [3.4K]3 years ago
8 0

Answer:

There is a moderate variation in birth weight.

Explanation:

You might be interested in
Why do you think exact measurements matter in recipes? Write in complete sentences what you think and why.
natali 33 [55]

Answer:

if ur makin a cake for instance and it calls for on tbs of salt and u add 5 cups that will be delicious right lol no i think it matter coz u need to put the right amount or it might turn out nastyyyyyyy

or it might have a chemical reaction that can affect how it cooks

Explanation:

hope this helps

have a epic day

xoxo

8 0
3 years ago
How have humans caused damage and change to each of the earths spheres
vampirchik [111]
Humans caused damaged by all the pollution in the earth atmosphere with is making global warming it changes by how much pullution is going into the atmosphere
3 0
3 years ago
Which of the following is a characteristic shared by most animals
Maurinko [17]

Collagen supported cells :)

7 0
2 years ago
Describe the beans shown in the picture. Make both objective and subjective observations.
Otrada [13]

Answer:

Black beans are tastier-subjective; White beans are the smallest-objective

Explanation: facts

8 0
3 years ago
This is a type of involuntary striated muscle found in the walls of the heart, specifically the myocardium​
Taya2010 [7]

Answer:

Cardiac Muscle

Explanation:

Your heart is a cardiac muscle so, any muscle related to the heart is a cardiac muscle.

5 0
3 years ago
Other questions:
  • Which of the following is NOT a branch of natural science ?
    12·2 answers
  • Skin cells are attached to the extracellular matrix by
    14·1 answer
  • When a hypothesis has been supported by observations from numerous experiments, it may be referred to as a __________.
    11·2 answers
  • What is heterochromia
    5·2 answers
  • ____ is a group of closely related organisms that share certain characteristics and can produce new individuals through reproduc
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the type of chemical weathering caused by oxygen in the atmosphere called
    15·1 answer
  • Why do plants supplies bacteria with amino acids ?
    10·1 answer
  • Which is an example of as-xual reproduction by cloning?
    13·2 answers
  • Acuity is better in the ___________ than in the ______________. Group of answer choices periphery; fovea optic disk; cornea opti
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!