1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aneli [31]
3 years ago
6

What effect might religious conflicts have on a country?

Biology
1 answer:
earnstyle [38]3 years ago
3 0
Well... a revolution for one. 
You might be interested in
Example of continuous characters in plants​
zepelin [54]

Answer:

Continuous variations are formed due to chance segregation of genes during gamete formation, crossing over and chance combination during fertilization.  They can increase adaptability of the race but cannot form new species.

7 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Why is it important to define what a living thing is?
natali 33 [55]

Answer:

So people know that everything has a value and they should appreciate it.

Explanation:

7 0
3 years ago
Read 2 more answers
Which is not something the respiratory system does?
Lapatulllka [165]
<span>The respiratory system deals with the body's breathing system, including the mouth, throat and lungs. An example of something the respiratory system doesn't do is anything with the digestive system. The digestive system consists of the mouth, throat, stomach, intestines and colon. It processes food and liquids into nutrients and energy for the body.</span>
5 0
3 years ago
In a short essay (100–150 words), explain how genetic information—along with an understanding of the process of descent with mod
loris [4]

Answer:

Evolutionary biology illustrates both the pattern and processes. The processes of evolution are natural selection and other mechanisms, which modifies the genetic structure of the populations. These processes result in evolutionary patterns, that is, the products generated by evolution with time.  

Phylogeny refers to the evolutionary history of a species or a group of species. In order to redevelop phylogeny, the scientists use systematics, that is, an analytical method to categorize the diversity and finding the evolutionary associations between the extinct and the living species.  

The evidence used to redevelop phylogenies can be attained from the fossil record and from the biochemical, morphological, and genetic similarities between the species. The scientists are functioning to develop a universal tree of all life, which will get refined with the gathering of new information.  

6 0
3 years ago
Other questions:
  • Explain why human eggs all contain one X chromosome
    15·1 answer
  • What is the fluid filled space that contains enzymes for the light independent reactions called
    11·1 answer
  • A student found a grasshopper in their backyard and wanted to take it to school to show the teacher the next day. Thestudent put
    15·1 answer
  • Please HELP will give brainist!DNA Replication Assignment
    9·1 answer
  • What does glucose get broken down to and where does it happen
    11·1 answer
  • Is one side of DNA is TCA, what is the other side?<br><br> A. AAA<br> B. TCA<br> C. AGT<br> F. TGA
    11·1 answer
  • The celery and potatoes in the salt water wilted and got soft because there was less water outside the cells. The water left to
    15·1 answer
  • Does fan spinning have energy? explain.​
    5·2 answers
  • Please help me with both! thank you:)
    5·2 answers
  • How do engineers use stem to create roller coasters
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!