1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
3 years ago
8

Which is not a characteristic of a person with

Biology
1 answer:
poizon [28]3 years ago
8 0

Answer:

Which is not a characteristic of a person with  cystic fibrosis?

Lack of pigment

Explanation:

cystic fibrosis affects cells in the digestive system and lungs as it has nothing to do with the skin pigment

You might be interested in
g During the G2 stage of interphase, ___ does not occur. A. organelle replication B. DNA growth C. protein replication D. cell g
ArbitrLikvidat [17]

Answer: DNA growth does not occur

Explanation:

Here, the cell has grown, the DNA has been replicated (this takes place in the S phase of interphase) and its almost time for the cell to divide. Basically, what occurs during the G2 phase (Gap 2 phase of interphase) includes duplication of all proteins and organelles needed later during the process of cell division. Some of these includes assembly of microtubles will later for the spindle structure that that helps in the separation of chromosomes during the M phase but these are produced during the G2 phase.

The cells also continue to increase/grow in size and the volume of the cytoplasm also increase in this phase. There is also a checking where the cell needs to check for the structures and components and to also ensure that they are all present

5 0
2 years ago
How many electron pairs does carbon share in order to complete its valence shell?
pogonyaev
Carbon shares 4 electrons to complete its valence shell
6 0
2 years ago
List 2 organelles found in an animal cell and explain how those 2 organelles benefit the cell.
pav-90 [236]

Answer:

I chose nucleus and the mitochondria

Explanation:

The nucleus is particularly important among eukaryotic organelles because it is the location of a cell's DNA. Two other critical organelles are mitochondria and chloroplasts, which play important roles in energy conversion and are thought to have their evolutionary origins as simple single-celled organisms.

Have a great day! :)

6 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
The words underlined above are the key processes of the exploration. Complete the following sentences. Transcription produces .T
mamaluj [8]

Answer:

Transcription produces --->mRNA

Translation takes place in the ---> Ribosome

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Explain why glucose consumption must increase in hypoxic tissues to provide the same amount of atp that could be produced from g
    8·2 answers
  • Desertification is caused by
    14·1 answer
  • What is the rock that has no exposure to chemical or mechanical weathering known as? Subsoil Topsoil Regolith Bedrock
    7·2 answers
  • In an ecosystem, every food chain begins with organisms that can create organic molecules from inorganic molecules; most frequen
    8·1 answer
  • Which of the following cells would not divide using mitosis?
    11·2 answers
  • Can you describe how hawaiian settlers negatively affected the islands after the 1700's?
    13·1 answer
  • T or F? A light year is a measure TIME on an astronomical scale.
    7·1 answer
  • Involuntary muscle includes _________.
    7·1 answer
  • What are found in the nucleus of an atom?
    14·1 answer
  • Help me please that will mean a lot to me if y’all help me
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!