1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harkovskaia [24]
3 years ago
8

What happens to a virus involved in the lysogenic cycle?

Biology
1 answer:
-Dominant- [34]3 years ago
5 0

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

You might be interested in
In ecosystems, plants transform light energy from the Sun into chemical energy when they make sugar. This sugar can then be cons
pav-90 [236]
The answer is D matter and energy shown in the question can change forms and is transferred to other locations for organisms to be used as building blocks for others.<span />
3 0
2 years ago
Read 2 more answers
As greenhouse gas concentrations increase across the globe in our atmosphere, we are observing
Triss [41]

Answer:

below

Explanation:

Greenhouse gas increases will cause an increase in desert areas on Earth. Current desert areas will grow as

temperatures cause increased evaporation. Humans will migrate away from these areas of low water and

productivity

7 0
2 years ago
Characteristics common to plants and animals regarding growth and reproduction are ______.
Lelechka [254]

Answer:

respiration, waste production, food intake, cells, breathing

7 0
3 years ago
How are photosynthesis and cellular respiration chemically opposite.
snow_tiger [21]

Answer: During photosynthesis, CO2 is absorbed and oxygen is released, whereas during cellular respiration, oxygen is absorbed and CO2 is released.

4 0
2 years ago
B. What is a spisogyne called a thallus, which type of
natulia [17]
Don’t click the link.
6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What type of biomolecule (lipid, protein, nucleic acid, or carbohydrate) is chlorophyll?
    8·1 answer
  • Why is it beneficial to use textiles made from synthetic fibers
    11·1 answer
  • How do biologists save lives WITH ANIMALS
    13·2 answers
  • 1. The student below is concerned with the survival of the plant in his aquarium.
    9·1 answer
  • Which is most responsible for the decay of dead organisms?
    15·2 answers
  • The average volume of a red blood cell is 87 μ m 3 . The mean concentration of hemoglobin in red blood cells is 0.34 g ⋅ ml − 1
    12·1 answer
  • A six-carbon sugar is an example of a ______ that can join with other molecules to form a _____ such as starch or cellulose
    14·2 answers
  • Do you know the names of any of the body parts of a male or female reproductive system?
    9·2 answers
  • TRUE OR FALSE: Paramecium can both photosynthesize and take in food through phagocytosis.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!