1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nydimaria [60]
3 years ago
8

Give an example of a specialized leaf system that is adapted specifically to its environment and explain how it works.

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
Th waxy coating over the surface of the leaves in xerophytic plants like cactus helps in preventing water loss by transpiration, and thus, helps them in maintaining turgor pressure and ultimately, in survival.
The cold-climate plants like pine, have needle-shaped small leaves, which help them in water conservation.
You might be interested in
Which layer of the atmosphere is closest to the surface of Earth?
bixtya [17]

Answer:

thermosphere

Explanation:

i think that one

3 0
3 years ago
Read 2 more answers
During a scene in Gattaca, Vincent’s parents visited a doctor to select for the best traits for his future brother. They hoped t
OverLord2011 [107]

Answer:

I would probably want to give my child one or two specific traits like intelligence or no inheritable diseases, because I would want my child to have a excellent chance of success in life.

Explanation:

8 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
A nurse is caring for a client on the second day postpartum. the client informs the nurse that she is voiding a large volume of
inysia [295]
The answer is that the nurse should identify is a UTI urinary track infection
7 0
3 years ago
Delila has a genetic disease that cause her to be weak and tired because her blood cells are not able to carry enough oxygen to
igor_vitrenko [27]
It might be sickle cell?
6 0
3 years ago
Other questions:
  • Under what circumstances would a muscle cell become fatigued?
    14·2 answers
  • What would happen if a cell didn’t have a cytoskeleton
    15·1 answer
  • Which of the following is an example of biological weathering?
    15·1 answer
  • Which of these sounds has the largest amplitude?
    5·1 answer
  • Which of the following statements about weather along mountain ranges is correct?
    10·2 answers
  • What is the main or role of sugars in food?
    7·2 answers
  • Which features of the sun are typical of stars
    10·2 answers
  • In an imaginary species of monsters, the gene for head shape has two sides. The dominant side (H) codes for square heads. The re
    8·1 answer
  • If a person exerts 150 N of force to move 10 meters, then how much<br> work did they do?
    12·1 answer
  • E. coli is a species of bacteria that causes many different infections in humans. certain e. coli strains have developed resista
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!