1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
8

What is mitosis??? Please explain in easy definition cz Google just has confused me...

Biology
2 answers:
alina1380 [7]3 years ago
8 0
Mitosis is a cell division
exis [7]3 years ago
4 0
Mitosis is when a single cell splits apart and creates two new cells that are identical to the parent cell.
You might be interested in
1. Which of the following is an accurate description of mitosis and meiosis? A. Mitosis produces two diploid daughter cells, whi
spayn [35]
A.
Mitosis is essentially creating more of the same type of cell (more diploid cells). Meiosis occurs in sex cells or gametes and produces cells witht he half the amount of chromosomes (haploid). 
6 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Identify the inputs and outputs of the muscular<br> system
Bess [88]
Connecting the worlds of engineering and regenerative medicine is no small feat and I hope that our last blog, which connected the human brain and the controller of an automation system, opened your eyes and allowed you to make some realistic associations between two distinct processes. With these blogs, we are propelling the industry forward by familiarizing both engineers and scientists with the worlds of a “different” industry.
5 0
3 years ago
How whould the different body system use the food
m_a_m_a [10]

Answer:

The body uses the food as energy (and proteins for bones).

Explanation:

ree

3 0
3 years ago
Which of the following is the opposite of aria?
satela [25.4K]

"Recitative" is the opposite of aria.

<u>Answer:</u> Option D

<u>Explanation:</u>

Musical oration of the kind common in the narrative and dialog sections of the opera and the oratorio, sung at the rhythm of the regular speech with several words along the same line is understood as Recitative.

While an aria is a long song that is performed by a single instrument and normally appears in an opera. It is an Italian word which means "air" in the 18th century. An artist would sing a song that would convey his or her emotions The aria had more interest in music than the recitative.

7 0
3 years ago
Other questions:
  • What is the definition of isotope
    10·1 answer
  • NEEDED ASAP PLS
    8·1 answer
  • Part E Water can exist in three different states of matter: solid, liquid, and gas. The water molecules are the same in each sta
    12·1 answer
  • If a stationary body of water has a constant temperature from top to bottom it is most likely a(n)
    7·2 answers
  • A 10-day-old, mechanically ventilated newborn suddenly develops a low heart rate (bradycardia) and low oxygen saturation, despit
    10·1 answer
  • Fossil fuels are full of energy stored from photosynthesis millions of years ago
    6·1 answer
  • Problems with which part of the bone would lead to the greatest loss of
    10·1 answer
  • Describe two benefits of using the SI system of measurement.
    15·1 answer
  • What are the two main reactions in photosynthesis called?
    10·1 answer
  • WILL GIVE BRAINLIEST (35 POINTS)<br> 1-8 QUESTION
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!