Answer: pathogen–host coevolution
Explanation:
A major driver of evolution is Reciprocal coevolution between host and pathogen. Rather than pathogen, one-sided adaptation to a nonchanging host, high virulence specifically favoured during pathogen–host coevolution. In all of the independent replicate populations under coevolution, the pathogen ( B. thuringiensis ) genotype BT-679 with known nematocidal toxin genes of C. elegans and high virulence specifically swept to fixation but only some of them go under one-sided adaptation,
so relative change in B. thuringiensis virulence was greater than the relative change in C. elegans resistance is due to the elevated copy numbers of the plasmid containing the nematocidal toxin genes
.
The two plates grab onto each other and lock in place is not a resulting situation of two plates colliding at a convergent boundary. When two plates colliding at a convergent boundary, what happenes is that one of the boundary either goes under or on top of the under, in order to release the energy that the two have stored because of the collision.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: Option D.
Rate of oxygen consumption.
Explanation:
Volume of oxygen used or Vo2 Max is the maximum ability of a person to consume oxygen and the ability of the heart, lungs and blood to transport the oxygen to other tissues and utilize it to produce ATP or energy during intense exercise.
