1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sladkih [1.3K]
3 years ago
5

which persuasive technique is used in the following excerpt to make a claim about the impact of climate change?

Biology
1 answer:
djyliett [7]3 years ago
3 0

Answer:

By providing the numbers in which methane is more powerful than carbon dioxide the author is appealing to the scientific facts to convince people that the greenhouse effect is destroying our planet, and that global warming is a reality that we must counter attack and treat as a priority.

Explanation:

For anyone with this question as a multiple choice question, itś D.

You might be interested in
Why do different types of cells do different jobs even though they contain the same dna
Inessa [10]
They contain different cell receptors and communication pathways
3 0
2 years ago
I need to know the correct answer
WINSTONCH [101]
2 that us the answer to your question
4 0
2 years ago
Read 2 more answers
Which structure is found only in plant cells and helps plants capture energy from sunlight?
Lynna [10]

Answer:

Chloroplasts

Explanation:

Chloroplasts are the food producers of the cell. The organelles are only found in plant cells and some protists such as algae. Animal cells do not have chloroplasts. Chloroplasts work to convert light energy of the Sun into sugars that can be used by cells.

5 0
3 years ago
Read 2 more answers
Unlike mosses and ferns, seed plants are able to live on mountains and in deserts. Why did this ability allow seed plants to rep
Pachacha [2.7K]
Seed plants became more versatile and able to live in various climates and areas which others could not, letting seed plants to reproduce much more rapidly 
5 0
3 years ago
Consider the abbreviated model of meiosis and the four gametes produced at the completion of meiosis II. Imagine that these game
den301095 [7]

The right answer is A) Trisomy

Aberrant karyotypes containing an abnormal number of chromosomes are known in the human species. The best-known (and most common) chromosomal abnormality is trisomy 21, which is responsible for Down syndrome (mongolism). There are others such as Turner syndrome (woman with a single X chromosome) or Klinefelter syndrome (man XXY).


These abnormalities originate from the non-disjunction of the chromosomes of a pair of homologues during metaphase I of meiosis. At the end of division I, a daughter cell contains the two chromosomes of the pair considered and the other cell does not contain a chromosome of this pair. A similar result can be obtained during a bad distribution of chromatids during anaphase II.


After fertilization from a gamete of this type, a trisomy or a monosomy is obtained.

4 0
2 years ago
Read 2 more answers
Other questions:
  • When the choking victim becomes unconscious cpr should be started without checking the pulse?
    13·2 answers
  • By using different types of technology, like weather satellites, radar, and river gauges, scientists can reduce flood damage and
    11·1 answer
  • Which of these is the BEST source of stem cells and minimizes the risk associated with stem cell transplantation?
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Organelles and the Characteristics of Life:
    10·1 answer
  • The researcher determines that the S value (number of species at equilibrium) for the island closer to the mainland is _________
    8·1 answer
  • Why were garden peas a good choice for a study of heredity?
    6·1 answer
  • A. Crossing over decreases genetic diversity
    5·1 answer
  • A rat gets light then shock until it responds to the light. Then, it gets light plus tone before shock for additional trials. In
    12·1 answer
  • Which environmental concern for climate is directly related to the growing urban population of the world?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!