1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
11

Access of therapeutic drugs to the central nervous system is restricted compared to that of other tissues because of the presenc

e of the _____
Biology
1 answer:
TEA [102]3 years ago
4 0

Answer:

blood brain barrier

Explanation:

hope this helps :(

You might be interested in
What were any obstacles/struggles the individuals with disabilities Education act had to overcome?
Sati [7]

Answer:

1. The Widespread Misperception That Teaching is Easy

Teaching is a uniquely difficult job, one that comes with a set of huge responsibilities; however, many people fail to recognize the teacher’s role. The various disabilities of the students with whom special education teachers work multiplies the job’s difficulty. Special education teachers are largely unrecognized and unsupported by the public.

2. Non-Instructional Responsibilities

Many teachers are trained and willing to teach but find themselves burdened with responsibilities that remove them from the classroom. Special education teachers often find themselves being required to go to meetings, conducting assessments and dealing with loads of paperwork.

3. Lack of Support

At a time when many large school districts are experiencing high levels of growth, special education teachers are being asked to do more with less. Salaries are being cut in many districts, and there is often very little in the way of technical assistance provided by school administrations.

4. Dealing With Multiple Disabilities

A special education teacher’s classes may have students with various disabilities. Since each student is a unique case, the teacher must modify their lessons to suit each disabled learner by providing individualized education programs.

5. Handling Death

Among students in a special education classroom, there are often some with severe chronic illnesses that may result in death. Handling this is a challenge to which special education teachers will have to adapt.

6. Handling the Problems of an Inclusive Classroom

The concept of having classrooms that contain both special needs students and students who are developing typically is becoming a popular one. This type of education poses new challenges for a special education teacher. For example, many students who have no disabilities are unaccustomed to dealing with those who do. Teachers in these classes are charged with eliminating cruelty and insensitivity from among their students and ensuring that those with special needs are treated with respect.

7. Professional Isolation

The nature of a special education teacher’s work is very different from that of traditional teachers; the result of this is that standard classroom teachers may not view them as colleagues. There may be a professional stigma attached to the work of teaching “slow” students. Special education teachers often work with smaller groups and may focus on skills rather than content, thereby leading to the perception that their work is easier or less important.

8. Lack of Support From Parents

Some parents of special needs children are disinterested in the welfare of their children and fail to provide them with adequate care. Alternatively, they may be overly protective. Both can be problematic for the child and for their teacher. Disinterested parents may have no involvement with their child’s education or interaction with their teachers, whereas overprotective parents may have unrealistic expectations from the child and the child’s teachers. Both attitudes can shape children in negative ways. Parental disinterest may make special needs students less motivated and parents who are overprotective often diminish their child’s confidence and make it harder for them to learn.

9. The Difficulty of Discipline in a Special Needs Classroom

Disabled children may have behavioral issues including restlessness and moodiness. They may also exhibit problems like a short attention span or an inability to understand what is being taught. Special education teachers have to learn how to deal with these problems as well as how to take appropriate disciplinary measures.

10. Budget Problems

Across the nation, special education programs are facing increasing enrollment and decreasing budgets. The result is that there are fewer teacher assistants available, which results in a greater workload for special education teachers. They may also face shortages of essential resources and equipment for delivering effective lessons.

Any one of these challenges would make the work of a special education teacher incredibly difficult; as a group, they turn the job into a set of arduous tasks. Unfortunately, the result of the pressures placed on teachers is that the students suffer. Anyone seeking to go into this area of teaching should be aware of what they will face and have the mental and emotional fortitude to overcome the challenges in order to improve the prospects of their students.

6 0
3 years ago
How many types of information are the inthe biology?
laiz [17]
Biology is a branch of science that deals with living organisms and their vital processes. Biology encompasses diverse fields, including botany, conservation, ecology, evolution, genetics, marine biology, medicine, microbiology, molecular biology, physiology, and zoology.

There are three main recognized branches of biology, which include botany, zoology, and microbiology.
6 0
3 years ago
When an organism such as a yeast lives by fermentation, it converts the pyruvate from glycolysis into a different compound, such
astra-53 [7]
I know that alcohol/ethanol is used as a growth stimulant and can be used in metabolism, thats one reason why the organism keeps pyruvate.
5 0
3 years ago
Help I need helpppppppoo
vesna_86 [32]
Meters per second. distance is meters and time is seconds
6 0
3 years ago
Read 2 more answers
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Other questions:
  • after it leaves the nucleus , mRNA brings codons to the _______ to be read and turned into amino acids & proteins ? Which is
    8·1 answer
  • Which of the following best describes similarities that exist between reptiles and amphibians?
    10·2 answers
  • What is the distance from the peak of one wave to the peak of the next wave called?
    9·2 answers
  • Which of the following represents asexual reproduction of a plant?
    9·2 answers
  • Which of the following accurately describes the relationship between photosynthesis and cellular respiration? A. Cellular respir
    9·1 answer
  • The single factor tested in an experiment is:
    11·2 answers
  • Hey any body want to pad let im soo bored<br><br> boys or girls i d c
    10·2 answers
  • Which piece of evidence did Wegener use to prove continental drift?
    7·1 answer
  • (3) The fabric made from these fibres is comfortable to wear, does not get wrinkled easily and easy to wash​
    11·2 answers
  • B. How does an Amoeba get its nutrition?<br>If answered correctly will be marked as brainliest.​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!