1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vazorg [7]
3 years ago
9

Why is this a scientific question? “ do people perform better on exams when they wear there favorite color”

Biology
1 answer:
Nookie1986 [14]3 years ago
8 0
Yes it is because there favorite color can possibly inspire them and their confidence to do do better.
You might be interested in
SOMEONE PLEASE HELP ME WITH THIS I WANT TO PASS THIS TEST
Ivan

Answer:

C

Explanation:

the mitochondria is the power house of the cell, just like the battery is a "power house" to an electronic

5 0
3 years ago
Which substance is a nuclear acid​
Ierofanga [76]

Nucleic acids are the biopolymers, or large biomolecules, essential to all known forms of life. The term nucleic acid is the overall name for DNA and RNA . They are composed of nucleotides, which are the monomers made of three components: a 5-carbon sugar, a phosphate group and a nitrogenous base.

4 0
3 years ago
Why are cells considered the basic unit of a living thing?
tatyana61 [14]
Because everything living starts with a cell
8 0
3 years ago
What is the full form of MFG in biology​
ICE Princess25 [194]

\huge\mathfrak {Answer:-}

mit freundlichem Gruß or mit freundlichen Grüßen

6 0
3 years ago
Read 2 more answers
When are the eggs in a woman’s ovary formed?
Nina [5.8K]

Answer:

When the boys sperm enters the ovary of the woman I guess. I am sorry if this doesn't help I was trying to think back to when I had health.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which is an example of how the peripheral nervous system helps the body maintain its internal environment?
    7·2 answers
  • Where in the mitochondria does the electron transport chain take place
    9·1 answer
  • Copy and complete this table to show the likely results of the experiment by placing the letters in the correct column. Explain
    11·1 answer
  • Which phrase best summarizes the theory of evolution by natural selection?
    9·2 answers
  • Which of the following provides the best comparison between reptiles and fish?
    6·2 answers
  • Question 1 of 26
    11·1 answer
  • PLZ HELP WILL MARK BRAIN Which of the following is NOT a component of carbohydrates?
    12·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The maps show the pattern of the migration of monarch butterflies each year,
    10·1 answer
  • One of the classmates is insisting that a feedback loop is a positive feedback loop because it is "doing good for the body". Wha
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!