1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
3 years ago
13

Which of the following practices can help control erosion?

Biology
2 answers:
ollegr [7]3 years ago
5 0
It would be B, contour plowing
Iteru [2.4K]3 years ago
3 0
I would go with recycling paper because if u recycle paper less erosion building up from other trash/junk.
You might be interested in
In pasteur's investigation, how did he make his test fair?
sp2606 [1]


Science

Toggle navigation

How the Scientific Method Works

BY WILLIAM HARRIS

 

Pasteur's Experiment


The steps of Pasteur's experiment are outlined below:

First, Pasteur prepared a nutrient broth similar to the broth one would use in soup.



8 0
3 years ago
Corn kernels have an outer endosperm and an inner endosperm. A purple outer endosperm is dominant to a
bonufazy [111]
I think the correct answer from the choices listed above is option E. The pattern of inheritance for the corn kernel color would be polygenic. It <span>occurs when one characteristic is controlled by two or more genes. Often the genes are large in quantity but small in effect. </span>
6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
In class we also talked about the metabolism of HDL particles.
zhuklara [117]

Answer:

Explanation:

The basis for the inverse relationship between number of matured HDL in circulation and and cardiovascular disease is that when new HDL entertainment circulation they mature by picking up extra cholesterol until they become mature and high cholesterol level is a major cause of cardiovascular disease and atherosclerosis. The implication of this is that the more the number of matured HDL in circulation, the lower the cholesterol level in the blood thus the lower the risk of cardiovascular disease and atherosclerosis.

3 0
3 years ago
When disinfecting a whirlpool foot spa after use by a client, you must circulate the disinfectant for ______________ or the leng
SIZIF [17.4K]

Answer:

10 minutes

Explanation:

8 0
3 years ago
Other questions:
  • What Is the difference in electrical charge between different parts of a molecule
    12·1 answer
  • Alternation of generations means that plants produce: a. only haploid multicellular organism b. only diploid multicellular organ
    10·1 answer
  • 15. Another name for the interstellar matter that will eventually form a star is ____.
    8·2 answers
  • Why do producers make up more biomass than primary consumers
    12·1 answer
  • "which plant group is the largest with the most number of living species"
    8·2 answers
  • Answer the question please
    15·1 answer
  • Harry notices that one of his houseplants does not grow very well compared to his other houseplants. He asks himself “What is di
    12·1 answer
  • On a weather map, wind speeds are related to____.
    5·1 answer
  • Which parasites are contrasted in the chart below?
    8·1 answer
  • A scientist studying natural selection would consider all of the following except
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!