1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neko [114]
3 years ago
7

In plants, whats is hard, protective structure inside which sperm cells form? ovule or ovary or anther or pollen grain

Biology
1 answer:
nataly862011 [7]3 years ago
4 0
The answer is the anther because an ovule and an ovary are female reproduction parts and a pollen grain does not produce sperm nor is it hard. 
You might be interested in
The dissolved sugars produces in the leaves of a maple tree move to the trees roots through the??
Whitepunk [10]

The dissolved sugars produced in the leaves of a maple tree move to the roots through the<em><u> phloem</u></em>. It is a tissue that transports nutrients to where it is needed

Hope it helps:)

3 0
3 years ago
Read 2 more answers
Which event signals the birth of a star?
juin [17]

Answer:

nuclear fusion

Explanation:

When the density and temperature at the core of the gravitationally collapsing nebula reaches values when nuclear fusion is triggered and sustained, that marks the birth of the star.

7 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
2 identical space orbiting Jupiter one has a larger gravitational force why
Rama09 [41]
This is because,
If the probes are identical, then the one that feels a larger gravitational 
force is orbiting closer to Jupiter than the other one is.
3 0
3 years ago
A bacterium that you isolated from pond water appears to use light for energy. Based upon this information, you inoculate the or
FinnZ [79.3K]

The question is incomplete as it does not have the options which are:

  • there was no sulfur compound added to the medium, that could be used as an electron donor.
  • no oxygen was added to the medium so the organism died.
  • there is some inhibitory chemical that is preventing the growth of the bacterium.
  • you were using the wrong type of sunlight as the energy source for the bacterium.

Answer:

There was no sulfur compound added to the medium, that could be used as an electron donor.

Explanation:

In the given question, the bacteria which are found in the pond uses light energy to use carbon dioxide and form the glucose molecule. These bacteria are known as phototrophic bacteria.

The process of photosynthesis requires an electron donor and an electron acceptor to use molecule.

The organism when provided the light and carbon dioxide artificially in a culture, the bacteria were not able to grow. The reason for this could be accounted as that there was no electron donor found in the media like sulfur which could donate the electron during the chain reaction.

Thus, the selected option is correct.

4 0
3 years ago
Other questions:
  • What percent of the time does a cell spend in telophase? (answer is found from the online activity)
    13·1 answer
  • A red shift in the spectrum of the light from an object indicates the object is moving ____ you.
    13·1 answer
  • white blood cells help protect the body from infection and disease-producting organisms. How might their function relate to thei
    11·1 answer
  • WILL GIVE BRAINLIEST!!!
    15·2 answers
  • Valuable metals are removed from ores during what process?
    7·2 answers
  • Knowing that the human body is approximately 60% water, and that some organisms live in water, what is the importance of tempera
    5·1 answer
  • Photosynthesis iPhotosynthesis is an example of
    12·1 answer
  • ¿que contamina mas?
    15·1 answer
  • A Giant factory farm uses large open lagoons to treat waste from the buildings where hogs are stored. The problem is that the la
    9·1 answer
  • Experiment 1 a group of students tested
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!