The dissolved sugars produced in the leaves of a maple tree move to the roots through the<em><u> phloem</u></em>. It is a tissue that transports nutrients to where it is needed
Hope it helps:)
Answer:
nuclear fusion
Explanation:
When the density and temperature at the core of the gravitationally collapsing nebula reaches values when nuclear fusion is triggered and sustained, that marks the birth of the star.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
This is because,
If the probes are identical, then the one that feels a larger gravitational
force is orbiting closer to Jupiter than the other one is.
The question is incomplete as it does not have the options which are:
- there was no sulfur compound added to the medium, that could be used as an electron donor.
- no oxygen was added to the medium so the organism died.
- there is some inhibitory chemical that is preventing the growth of the bacterium.
- you were using the wrong type of sunlight as the energy source for the bacterium.
Answer:
There was no sulfur compound added to the medium, that could be used as an electron donor.
Explanation:
In the given question, the bacteria which are found in the pond uses light energy to use carbon dioxide and form the glucose molecule. These bacteria are known as phototrophic bacteria.
The process of photosynthesis requires an electron donor and an electron acceptor to use molecule.
The organism when provided the light and carbon dioxide artificially in a culture, the bacteria were not able to grow. The reason for this could be accounted as that there was no electron donor found in the media like sulfur which could donate the electron during the chain reaction.
Thus, the selected option is correct.