1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
3 years ago
15

Which test tube, A or B, have you determined has the most sugar based on the results of the Benedict's test for monosaccharides?

Biology
1 answer:
andreyandreev [35.5K]3 years ago
7 0
It’s gonna be A definitely
You might be interested in
Pls I need help with this question they didn’t say anything about it
oee [108]

Answer:

I don’t know

Explanation:

5 0
3 years ago
Please help!! This is Science
Elenna [48]
C because of the same time we had a lot to
6 0
3 years ago
Read 2 more answers
How do populations respond to external stimuli?​
TEA [102]
Receptors are groups of specialised cells. They detect a change in the environment stimulus. In the nervous system this leads to an electrical impulse being made in response to the stimulus. Sense organs contain groups of receptors that respond to specific stimuli.
7 0
3 years ago
Which is not a precaution taken at nuclear power plants to ensure safety? PLS HELP!
Oliga [24]
I think the answer is A, i dont know for sure tho. But it's the only one that makes sense to me.

Sorry if it's wrong

Hope this helps!! :-)
6 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Other questions:
  • How does water and other molecules move across the membrane and in various solutions to maintain homeostasis
    14·1 answer
  • How many know satellites does mars have?<br><br> One<br><br> Two<br><br> None<br><br> Five
    12·2 answers
  • What material has the greatest density
    13·2 answers
  • The stomach empties into the small intestine through the _______
    7·1 answer
  • Which of the following is an example of the letter "o" in a SOAP note?
    14·1 answer
  • Spit lab hypothesis
    8·1 answer
  • All organisms require nitrogen to make amino acids, which in turn are used to build what?
    11·2 answers
  • A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). To compare a sp
    8·1 answer
  • 59.33
    13·1 answer
  • !!!!!!!!!!!!PLEASE HELP ME PLEASE PLSEASE!!!!!!!!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!