1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
2 examples of transfer by contact, induction, and conduction
Bogdan [553]

Answer: The two examples of conduction and induction are as follows.

Explanation:

Conduction can be defined as the process of transfer of charges from the charged body to the neutral body by direct contact whereas the induction is a process in which the charges are induced in the neutral body by the charge body. The conduction process requires the direct contact between the bodies in which the charges are being transmitted.

The example of the conduction process involves the neutral metal sphere gets charged when comes in contact of aluminum plate that exhibit a charge.

The example of induction is the rubbing of the rubber balloon with that of the animal fur then the two balloons will move away due to like charge repel each other.  

8 0
2 years ago
A substance has a half-life of two days. If 10 days have passed, how many half-lives have the substance gone through?
andrew11 [14]
It’s five isn’t it because Yk 10/2
6 0
2 years ago
24. An investigator examines voltages resulting from changes in membrane permeabilities. If the cell membrane suddenly had 100 p
omeli [17]

Answer:

Generally, K+ ions ensures re-polarization of  the membrane potential. It always ensures that the neuron returns its resting  state, protecting the  neurons and ensuring episode of rest before the next action potential.

K+ does this by leaving the axon, making the inner layer more negative. This is resting membrane potential. Because there are many K+ channels for leakages out of the neuronal axons.

Therefore, in this scenario, he neuron will return to its resting membrane potential state which between values -50 to -75mV.

Therefore the value of the potential will be -60mV, or within the range of -50 to -60mV. This is because the neuron is is non- excitable.

Explanation:

7 0
2 years ago
SOMEONE PLEASE ANSWER THIS, it’s about caves
Vera_Pavlovna [14]

This is all i know about caves: Caves are large, natural holes beneath the surface of the earth. Underground passages and caves are found in rocky landscapes across the world. They are found in areas with a lot of limestone, a common type of rock. They can be created in various ways, but most caves are hollowed out of rock by water.

8 0
2 years ago
Read 2 more answers
What should you do with its contents if you are done using a test tube?
umka21 [38]
If a test tube has been used, and its contents is supposed to be disposed, carefully pour the contents to the lavatory with a confirmation of a professional (as it may damage the pipelines of the sink) and ensure that there are no splashes created that can contact the human skin. Wash the test tube thoroughly and let dry.
4 0
2 years ago
Other questions:
  • The major causes of death that account for the large differences in life exxpectancy between less developed and more developed c
    5·2 answers
  • In early spring, many wildflowers begin to grow, produce flowers, and release seeds. The leaves of the wildflowers make food bef
    9·1 answer
  • types of volcanic mountains in terms of shape, type of eruption, and the minerals that make up the volcano
    14·1 answer
  • Which factors can prevent permanent fixation of an allele (i.e. maintain genetic diversity)? Hint: You're going to have to try d
    12·1 answer
  • What is a cell with two pairs of each set of chromosomes
    6·1 answer
  • Describe a similarity and a difference between meiosis I and meiosis II
    8·1 answer
  • What embryonic structures are common in all chordates?
    8·1 answer
  • Which two organisms are able to form a symbiotic relationship with each other
    10·1 answer
  • If you happen to know the answers or at least some please please please let me know it would help so much
    14·1 answer
  • Which of the following best describes the product of RNA translation?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!