1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
How are important properties of mercury venus and mars different from important properties of earth?
Gnoma [55]
<span>Mars is a little more than half the size of the earth.It is reddish in colour unlike earth.Earth has oneoon, Mars has two moons.Jupiter is larger than earth.Jupiter has four rings whereas earth does not have any.Earth is suitable for life due to the presence of water ,but Mercury has a toxic atmosphere.Mercury is hotter than earth.</span>
8 0
3 years ago
Heat energy trapped by particles in the atmosphere warms the earth naturally through the
Molodets [167]
Through the process of global warming
5 0
3 years ago
Read 2 more answers
Termination of the abdomen in which the anus is located *
densk [106]

Answer:

Telson

Explanation:

its the last segment of the abdomen.

8 0
3 years ago
Which of the following is the correct Lewis structure diagram for Sodium (Na)? (2 points)
Over [174]

Answer:

a. The letters Na with one dot

Explanation:

An atom can be defined as the smallest unit comprising of matter that forms all chemical elements. Thus, atoms are basically the building blocks of matters and as such determines or defines the structure of a chemical element.

Generally, atoms are typically made up of three distinct particles and these are protons, neutrons and electrons.

In Chemistry, electrons can be defined as subatomic particles that are negatively charged and as such has a magnitude of -1.

Valency can be defined as a measure of the combining power of a chemical element with other atoms to form a molecule or chemical compound.

Valence electrons can be defined as the number of electrons present in the outermost shell of an atom. Thus, valence electrons are used to determine whether an atom or group of elements found in a periodic table can bond with others.

Sodium is a chemical element that is found in group (1) of the periodic table and as such it has 1 electrons in its outermost shell. Also, the chemical symbol for Sodium is Na and it has one (1) valence electron.

A Lewis structure can be defined as a structural representation of an atom or molecule by using a dot to show the position and distribution of electron(s) around the atom or molecule.

Hence, the letters Na with one (1) dot is a correct Lewis structure diagram for Sodium (Na) because it has just one (1) valence electron in outermost shell.

For example, the Lewis structure diagram for Sodium (Na) is •Na.

5 0
3 years ago
What components contributes to the mass of a photosynthetic organism
Semenov [28]

Answer:

The mass of a tree is primarily carbon. The carbon comes from carbon dioxide used during photosynthesis. During photosynthesis, plants convert the sun's energy into chemical energy which is captured within the bonds of carbon molecules built from atmospheric carbon dioxide and water

8 0
2 years ago
Read 2 more answers
Other questions:
  • Complete the analogy below.
    13·2 answers
  • What function do nucleic tides serve besides storing genetic information
    7·1 answer
  • Cells are grouped by the ______ they do
    9·1 answer
  • What type of venom does a cottonmouth have
    15·1 answer
  • Darwin observed that the finches on two different islands in the Galapagos belonged to the same family, but showed a lot of vari
    15·2 answers
  • What serves as the body's chief storage site for lipids?
    7·1 answer
  • Medical professionals are concerned with the increase in the number of bacterial species that are resistant to antibiotics. Once
    11·2 answers
  • ANSWER THE QUESTIONS RIGHT AND YOU WILL GET 50 POINTSSS!!!!!!!!!
    9·1 answer
  • How do the various part of the body work together when we eat something
    7·1 answer
  • Why does a psychologist want the results to be statistically significant?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!