1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
What would happen to human blood cells if they were placed in a salt water solution?
OLEGan [10]

Answer:

The red blood cells will shrink in size when water diffuses out of them.

7 0
2 years ago
How many protons are in the nucleus of an atom with an atomic number of 12?
Akimi4 [234]

<h3>16 protons</h3><h2> </h2>

I hope it helps for you

4 0
3 years ago
What is extinction ?
ASHA 777 [7]

Answer:

the fact or process of a species, family, or other group of animals or plants becoming extinct.

Explanation:

extinct means the disappearance of something meaning it is no longer alive or reproducible

4 0
3 years ago
Read 2 more answers
19. What's evaluated at the G2 checkpoint in mitosis and meiosis?
Vedmedyk [2.9K]

Answer:

D

Explanation:

The G2/M check point makes sure that <u>all of the chromosomes have been replicated.</u>

- <em>Is all DNA replicated?</em>

- <em>Is all DNA damage repaired?</em>

5 0
3 years ago
Read 2 more answers
What is the codon-anticodon complementary base pairing system
Umnica [9.8K]

Answer:

​Anticodon

An anticodon is a trinucleotide sequence complementary to that of a corresponding codon in a messenger RNA (mRNA) sequence. An anticodon is found at one end of a transfer RNA (tRNA) molecule.

Explanation:

4 0
3 years ago
Other questions:
  • DNA is not in a_________
    6·1 answer
  • PLEASE HELP!
    11·1 answer
  • What type of wave is sound?
    14·1 answer
  • The following is what type of sentence? dogs and cats sometimes fight in a veterinarian's wating room.
    12·2 answers
  • A/An ____________________ is a technique of mechanically widening a narrowed or obstructed blood vessel.
    14·1 answer
  • What is Uranium’s atomic number
    13·2 answers
  • WILL BE MARKED AS. BRAINLIEST The process of inflammation _____.
    9·2 answers
  • Why are nerves the longest cells in the body?
    6·1 answer
  • If 5% of a DNA sample is made up of thymine, C, what percentage of the sample is made up of cytosine, A?
    11·1 answer
  • What structure can be found in both a virus and a cell? <br> I’ll make you brainiest
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!