1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
Anthropologists use the term ____________ to refer to the process of learning your culture, ordinarily as a child.
zysi [14]

Anthropologist use the term Enculturation to refer to the process of learning your culture, ordinarily as a child.
7 0
3 years ago
What evidence can you use from these images to support the claim that the skulls represent the evolution of a species?
max2010maxim [7]
As you can see the structure of the entire go have changed from a low set posture to a rounded figure. you can also see changes in the jaw shape and the bed of the school you can also see different dynamics in the dents etc within the skull . as you can see the beginner skull is reminiscent of animalistic features and crude shaping.
4 0
3 years ago
If a women has sex-linked recessive trait, then all of her sons will have trait as well.
julia-pushkina [17]

Answer:

true

Explanation:

5 0
3 years ago
What is always a property of an ore?
lakkis [162]
Chemical composition is always a property of an ore. 
6 0
2 years ago
Which passageway connects the third and fourth ventricles?
Yakvenalex [24]

Answer:

Cerebral Aqueduct

Explanation:

7 0
3 years ago
Other questions:
  • Which of the following is NOT a subatomic particle?
    5·1 answer
  • "Plants are able to continue to grow and develop once the starch supply in the seed is gone, because they
    12·2 answers
  • Soft-shell crab is a prized dish in many ocean-side resorts. Why are the crabs' shells soft? Soft-shell crab is a prized dish in
    11·1 answer
  • A way of separating a large group of closely related organisms into smaller subgroups is
    10·1 answer
  • 1. What is an invasive species?
    5·1 answer
  • After surgery for removal of cataract, a client is being discharged, and the nurse has completed discharge instruction. Which cl
    12·1 answer
  • Groundwater can stay underground for long
    11·1 answer
  • Where is the diaphragm located? between the ribs inside the lungs below the lungs above the ribs
    5·2 answers
  • Hemophilia is an X-linked recessive disorder.
    11·2 answers
  • What’s one indirect consequences of building Seawalls
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!