1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
How is the the net production (NP) of a crop field calculated? What are factors that will affect the NP?
hjlf

NPP can be directly assessed by measuring plant traits or harvesting plant material on the ground, but across large areas remotely sensed images can be used to estimate NPP.. im trying to help

6 0
3 years ago
Read 2 more answers
The lithosphere and asthenosphere make up the upper mantle.
Marizza181 [45]

Answer:

the answer is true bro

Explanation:

8 0
4 years ago
Read 2 more answers
During translation a what is created between two amino acids
kogti [31]

Answer:  chemical bond

7 0
4 years ago
What is the composition of the asthenosphere?
BartSMP [9]

The asthenosphere lies 80-200km below the surface under the lithosphere. Convection also occurs in the asthenosphere. The asthenosphere is mostly made of up rock material (magnesium and iron silicates). The asthenosphere makes up 6% of the mantle and lets the lithosphere move.

Best of Luck!

5 0
3 years ago
Stack of membranes that packages chemicals
iogann1982 [59]

Answer: golgi apparatus.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • What two factors determine the shape of a protein?
    6·2 answers
  • Glycolysis and gluconeogenesis are opposing pathways in that they begin or end with the same metabolites and share common interm
    5·1 answer
  • Gymnosperms typically reproduce by _____________ pollination. A) animal B) insect C) water D) wind
    12·1 answer
  • What are the characteristics of a buckeye leaf?
    11·2 answers
  • Which substances may form in the human body due to invaders entering the blood
    10·2 answers
  • Which is true?
    9·1 answer
  • The red fox lives in temperate regions and has a dark, reddish coat to help it hide from predators. The kit fox is sandy-colored
    6·1 answer
  • A small group of yellow violet plants become isolated from a larger yellow violet plant population. This results in a change in
    12·1 answer
  • What makes one mineral harder than the other? Explain
    9·2 answers
  • What are some examples of structural and behavioral adaptations
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!