1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
What is plants that produce flower or fruit
tensa zangetsu [6.8K]
Angiosperms produce flowers and fruits
6 0
3 years ago
A zygote forms when a sperm cell penetrates and fertilizes an egg. <br> a. True<br> b. False
Georgia [21]

Answer:

the answer is true. a zygote does

4 0
3 years ago
What would happen to an organism if its cell membranes became permeable to most substance
Hatshy [7]
A) It would die as harmful substances entered the cell
5 0
3 years ago
Read 2 more answers
Yeast cells reproduce quickly by budding. This is a form of ___________ reproduction so all the yeast cells ____________.
almond37 [142]
C) asexual and are identical
7 0
3 years ago
Read 2 more answers
For each sentence below, select the name of the specialized cells being described.
igor_vitrenko [27]

Answer:

1: Neurons

2:White Blood Cells

3:Epithelial Cells

4:Red Blood Cells

5:Muscle Cells

Explanation:

Edge2020

3 0
3 years ago
Read 2 more answers
Other questions:
  • Mitosis is characterized by four stages. select the list of stages in the correct chronological order.
    5·1 answer
  • A single-celled zygote develops into a multicellular organism with specialized cells through the processes of
    8·1 answer
  • Personal values and work values cannot be related. ture or false?
    9·1 answer
  • These penguins are all members of the species Aptenodytes patagonicus. What is the difference between a species and a population
    9·1 answer
  • Biology ecology unit review protect
    10·1 answer
  • 1. What process reduces the level of carbon dioxide in the atmosphere.
    13·1 answer
  • A surfactant is a chemical that disrupts hydrophilic/hydrophobic interactions, letting normally hydrophobic things dissolve in w
    11·1 answer
  • The central nervous system includes
    5·2 answers
  • The largest ape that walked on Earth was a prehistoric
    7·1 answer
  • The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!