1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
Cell membranes contain a central bilayer formed by - A. lipids / B. protein pumps / C. carbohydrates, / D. proteins
mario62 [17]
Cell membranes contain a central bilayer formed by lipids. This protect that membrane.
8 0
3 years ago
Consider the following prediction.
natka813 [3]

The correct answer to this question is:

“The prediction is useful because it explains what observations will be made if a hypothesis is true.”

6 0
3 years ago
Read 2 more answers
ateo goes to his doctor after experiencing discomfort for a few days. Following tests and an examination, the doctor tells Mateo
RUDIKE [14]
This is a case of acute or chronic (or acute on chronic) kidney disease. Mateo should take diuretics or drugs that induce tubular secretion and/or water excretion and therefore urination. If kidney disease worsens, the patient will undergo filtration of waste products from his blood or this is called hemodialysis. There is another way of filtering waste products using the fluid in the peritoneum called peritoneal dialysis. Other complications of chronic kidney disease is anemia as erythropoeitin (functions to signal the production of red blood cells) is produced in the kidneys.
3 0
3 years ago
Read 2 more answers
What is one negative effect of human influence on cycles of matter?
ycow [4]

honestly for me its between 2 and 3

6 0
3 years ago
Read 2 more answers
What part of DNA provides the code for proteins?
notka56 [123]

Answer:

Gene

Explanation:

The genome of an organism is inscribed in DNA, or in some viruses RNA. The portion of the genome that codes for a protein or an RNA is referred to as a gene. Those genes that code for proteins are composed of tri-nucleotide units called codons, each coding for a single amino acid.

4 0
2 years ago
Other questions:
  • Joey has been huffing toluene with friends when he suddenly collapses, not breathing and with no pulse. what should his friends
    11·1 answer
  • What is the major source of air pollution today?
    8·2 answers
  • This map shows the geographic distribution of different tidal cycles along some Earth's coastlines. Areas experiencing
    13·1 answer
  • A sapling starts off 12 inches y’all and over the course of many years becomes 48 inches tall which characteristics of life is b
    11·1 answer
  • What does therapeutic cloning involve?
    8·1 answer
  • In an electrophoretic study of enzyme variation in a species of pelican, you find 77 A1A1, 45 A1A2, and 18 A2A2 individuals at a
    12·1 answer
  • 4. If a mutation blocked the function of the signal recognition particle, making it unable to bind signal sequence, what would r
    13·1 answer
  • Which of the following is an external stimulus? O A hunger O B. sunlight O c. instinct OD. tropism​
    15·1 answer
  • What are California's major mineral resources
    7·1 answer
  • 1. Herbivores are also called__________consumers.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!