1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
Why is biomass at the second trophic level in most ecosystems not as great as biomass at the first trophic
alexira [117]
Only about ten per cent of the biomass is transferred from each trophic level to the next. The remaining 90 per cent is used by the trophic level to complete life processes . Biomass can be lost between stages because not all of the matter eaten by an organism is digested.
7 0
3 years ago
During respiration, what do consumers such as animals release?
xxTIMURxx [149]

Answer:

Carbondioxide and water

Explanation:

During respiration food molecules are broken down to release energy. During this process oxygen is required and not formed but Carbondioxide and water is liberated as byproduct. So the closest answers are Carbondioxide and water

7 0
3 years ago
Organisms that rely on other living things for food are called
Katarina [22]
Carnivores (animals that eat other animals/humans for food)
5 0
3 years ago
Read 2 more answers
When a protein denatures, which type of bonding is effected?
GenaCL600 [577]

Answer:

When a protein is denatured, secondary and tertiary structures are altered but the peptide bonds of the primary structure between the amino acids are left intact. Since all structural levels of the protein determine its function, the protein can no longer perform its function once it has been denatured.A protein becomes denatured when its normal shape gets deformed because some of the hydrogen bonds are broken. Weak hydrogen bonds break when too much heat is applied or when they are exposed to an acid (like citric acid from lemon juice).

3 0
2 years ago
A molecule of one atom of carbon and two atoms of oxygen would be written
Setler [38]
Hey, how are you doing?

The answer to your question would be: CO_{2} i believe. 
Hope this helps, and if you need further help, contact me!

Thank you,
Darian D. 
7 0
4 years ago
Read 2 more answers
Other questions:
  • How far and what direction does the decimal move from centimeters to kilometers?
    10·2 answers
  • Why is a second blood test necessary three months after a person thinks he or she has been exposed to hiv?
    13·2 answers
  • You want to estimate the number of canvas backs (a type of duck) at the Sacramento Wildlife Refuge. In two days you capture 200
    11·1 answer
  • Where do plants get the nitrogen they need to create amino acids and DNA?
    9·2 answers
  • What initiates translation
    8·1 answer
  • If the codon is GUC, what is the anticodon
    9·2 answers
  • 2. The cytoskeleton of animal cells includes three types of proteins, and the cytoskeleton of plant cells includes two types of
    14·1 answer
  • In an expirement a piece of brain was removed from a rat .It was found that the rat had large fluctuations of body temp.Suggest
    10·1 answer
  • Explain in detail what transpiration is and how it affects the flora of the earth.​
    13·1 answer
  • 2
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!