1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
Which three observations provides evidence of a cold air mass is moving towards a warm moist air mass over a city? ASAP 20 poin
anygoal [31]
I think it is C, D, and E goodluck
4 0
2 years ago
What is the function of the flower in plant reproduction?
erik [133]

Answer:

attracts pollinators

3 0
3 years ago
C'est quoi l'hypophyse
klasskru [66]

Your ugly, no offense your weird no offense

3 0
2 years ago
Read 2 more answers
Most cells can only be seen with:
REY [17]

Answer: a microscope

Explanation:

4 0
3 years ago
Read 2 more answers
What does Na+ represent? Select all that apply.
qwelly [4]
Positive sodium ion!

4 0
3 years ago
Read 2 more answers
Other questions:
  • According to the miasma theory of disease what is the cause of the illness
    12·1 answer
  • 1.What is an effective method for reducing the amount of unwanted gases released into the air by a power plant?
    15·1 answer
  • ____________ smoking is the most toxic way to smoke tobacco.
    5·1 answer
  • A farmer is being troubled by coyotes eating his sheep. in an attempt to solve the problem, he kills a sheep and laces its body
    5·1 answer
  • 6. During which type of reproduction can a single organism reproduce
    7·1 answer
  • What percent of North America is covered by forest
    12·2 answers
  • Your significant other is an amazing chef. When you come home from lecture, the smell of whatever she or he is cooking makes you
    8·1 answer
  • State your hypothesis (developed in step 8) here. be sure to include what you think the ph will be, and why. what is a neutraliz
    8·1 answer
  • WILL MARK BRAINLIEST!!!
    10·2 answers
  • How does the pleura help with breathing?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!