1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
Plants that produce seeds within a cone are called _____.
Sedbober [7]

Answer:

Gymnosperm

Explanation:

8 0
3 years ago
Which of the follling is not true about detuals view?
olchik [2.2K]
Where are the answer choices
8 0
3 years ago
Can carbon move from a living component of an ecosystem to a nonliving component
DIA [1.3K]

Answer:

yes

Explanation:

because carbon can travel anywhere

4 0
3 years ago
Describe This plant cell has been sliced in help and you are looking into one of the halves. How would you describe the structur
Veseljchak [2.6K]
Plant cells are the basic unit of life in organisms of the kingdom Plantae. They are eukaryotic cells, which have a true nucleus along with specialized structures called organelles that carry out different functions.They also have a cell wall that provides structural support.
3 0
3 years ago
If you subtract the atomic number from the weight, what is the interpretation of the answer? (e.g. 14-7=7; Think of a subatomic
viva [34]
If we subtract the atomic number from the weight, we get the number of neutrons in the particle. This is because protons and neutrons each have a weight of 1, while electrons are 0. And since the atomic number is also the number of protons in the atom, subtracting it from total weight gives us the number iif neutrons.
4 0
3 years ago
Other questions:
  • Speed and velocity are similar, but which thing makes them different?
    15·2 answers
  • Study the illustration. The small blue spheres represent water molecules.
    13·2 answers
  • Which of the following may have been an advantageous adaptation for the jackrabbit?
    8·2 answers
  • What type of reaction is photosynthesis
    9·1 answer
  • Is global warming an imminent world threat of so what should be taken address of the issue
    5·1 answer
  • Match each statement to the type of behavior it describes.
    5·1 answer
  • How is water used in the environmet
    11·1 answer
  • The amount of oxygen in Earth's atmosphere has been a constant for millions of years.
    11·1 answer
  • 4. How does an organism's traits increase its chances for survival? Give a specific example and explair in detail​
    14·1 answer
  • What questions you would like to ask your teacher to know about the role of vaccine in prevention of harmful diseases ​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!