1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Biology
1 answer:
AnnyKZ [126]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

You might be interested in
BRAINLIEST! Are fish mammals
siniylev [52]

Answer:

No

Explanation:

Fishes lay eggs and are not warm blooded vertebrates and don't have hair or fur

4 0
3 years ago
Read 2 more answers
Where does the sun set east or west
matrenka [14]

Answer:

West

Explanation:

The sun rises in the east and sets in the west

4 0
3 years ago
The Tasmanian devil has 14 chromosomes in each of its somatic cells, 2n = 14. How many chromosomes would be present in a cell af
nikitadnepr [17]
How many chromosomes would be present in a cell after anaphase of Mitosis?
During anaphase, sister chromatids separate to opposite sides of the cell. Therefore the 4n after doubling returns to 2n at each end of the dividing cell after anaphase. But until cytokinesis (1 cell pinching into 2), it's still one cell therefore 4n = 28
6 0
3 years ago
Read 2 more answers
Do biologists fully understand DNA now?
harkovskaia [24]

Biologists do not fully understand DNA because there are constant changes and new discoveries developing.

8 0
3 years ago
Read 2 more answers
7. What is the kinetic energy of a 3-kilogram ball that is rolling at 2 meters per second?
nydimaria [60]
Kinetic energy = 0.5*M*V^2 

 Q7-
 
0.5*3*(2^2)= 6J

Q8a- 

0.5*2*(2^2)= 4J
0.5*4*(3^2)=18J 
the second ball has more kinetic energy.

Q8b-

at the max height, all the kinetic energy is converted to potential energy, 

gravitational potential energy is = M*g*h

that theory would apply if you wanted to work out the maximum height achieved if the balls were thrown upward by rearranging. But, we are simply working out which ball will have more potential energy so:

First ball:
2kg*9.81(g)*10m = 196.2J

Second ball
4kg*9.81*10m= 392.4J

The second ball has more potential energy 


5 0
3 years ago
Other questions:
  • Which characteristics is found in the whale but no in the phytoplankton
    9·1 answer
  • The list shows the scientific names for eight animals, using the binomial system. Which two animals are most closely related?
    15·1 answer
  • The only t cells that can directly attack and kill other cells are the ________.
    14·1 answer
  • What is a major difference between mitosis and meiosis I in a diploid organism?
    13·2 answers
  • Which could be its function?
    11·2 answers
  • QUICK PLS
    6·1 answer
  • What are the products of aerobic cellular respiration? Check all that apply.
    13·1 answer
  • Organisms need ___ to conduct essential life activities
    10·2 answers
  • I need help with this
    10·1 answer
  • What is the cause of lightning?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!