1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ira Lisetskai [31]
3 years ago
11

What is a possible benefit of studying plants in the rainforest? 1) The Plants may hold medicines to treat human diseases - 2) T

he plants may produce need it carbon dioxide - 3) The plants may be cut down and sold in floral shops - 4) The Plants may make Toxins for human consumption
Biology
1 answer:
elixir [45]3 years ago
5 0

Answer: The plants may produce needed carbon dioxide.

Explanation:

This is the only benefit as medicine needs to be found, they won't be cut down, and they do take in toxins but it does not affect the study

You might be interested in
What is the name of the process in which the organism best adapted to their environment survive
olya-2409 [2.1K]

I believe the word you're looking for is Evolution?

8 0
3 years ago
Read 2 more answers
Someone help with me this :/
il63 [147K]
First

Crude oil is piped from an underground reserve to the surface.

Crude oil is transported to a refinery by pipeline or tanker

crude oil is refined to make gasoline and other products.

Gasoline is transported by tanker truck to a gas station

Gasoline is pumped into a car‘s gas tank.
5 0
3 years ago
What did Richard current mean when he described the civil war after the summer of 1863 as a “war of attration”
gulaghasi [49]
<span>Southern generals remained able to engage Union forces without additional troops or supplies. </span>
5 0
4 years ago
Which organisms break down decaying organisms and produce an inorganic nutrient pool in ecosystems?
allochka39001 [22]

Answer:

Decomposers

Explanation:

Decomposers eat decaying or dead organisms to produce the nutrients.

8 0
3 years ago
Describe a chemical property of oxygen that you observed
ra1l [238]
At standard temperature and pressure (STP), two atoms of the element bind to form dioxygen, a colorless, odorless, tasteless diatomic gas with the formula O2. Oxygen is a member of the chalcogen group on the periodic table and is a highly reactive nonmetallic element.
4 0
4 years ago
Other questions:
  • What types of molecules are broken down to make ATP? Which are most common?
    14·1 answer
  • Which organelle is made of a phospholipid bilayer? A. cell wall B. cytoplasm C. ribosome D. cell membrane
    13·2 answers
  • A cytoprotective agent is also known as a(n) _____.
    11·1 answer
  • Explain the relationship between the Earth's crust and the Earth's ocean sizes.
    9·1 answer
  • Could someone help me with my 200+ Q Biology review?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Are inorganic coumpounds not made of elements?
    7·2 answers
  • Help ASAP!!!! 20 points.
    10·1 answer
  • List several functions of G protein-coupled receptors
    7·1 answer
  • What is a type of ecological experiment that takes advantage of a natural disturbance and for which there is no ability to regul
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!