<span>Compound Microscope
Compound microscope is commonly used in the schools and colleges.
It comes under the category of microscopes used in biology.
It has two lenses namely the objective lens and the ocular lens.
It provides a magnification of 1500X.
Eyepiece lens is of 10X or 15X power.
It is used to observe bacterial, protozoa, various cells, etc.</span>
Answer:
High specific heat capacity.
Explanation:
Thermoregulation is the ability of an organism body to maintain it's internal temperature. It is an important aspect of homeostasis which is ability of an organism to maintain internal temperature not minding the surronding environment.
Blood have high specific heat capacity which help to maintain body temperature. Blood absorbs and distribute heat to the body, so as to maintain homeostasis. Blood vessels contracts when they react with outside environment.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
The homogeneous mixture is only in the one phase of matter, whereas heterogeneous mixture is always in two or more than two different phases of matter. Solutions are termed as the homogeneous mixtures, on the other hand, suspensions or colloids are termed as the heterogeneous mixtures.
Examples:
Homogeneous:
Bronze: this alloy is an example of homogeneous substances since it is composed of tin and copper.
Milk : this mixture that we see in a uniform way is composed of substances such as water and fats.
Heterogeneous:
Mixtures in two or more phases are heterogeneous mixtures. Examples include ice cubes in a drink, sand and water, and salt and oil. The liquid that is immiscible form heterogeneous mixtures. A good example is a mixture of oil and water.
The answer is Sea Turtles since dinosaurs are already extinct
