1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hram777 [196]
3 years ago
14

¿Que tipo de inmunidad participa en la defensa del cuerpo contra el Coronavirus.?

Biology
1 answer:
viva [34]3 years ago
6 0

Answer:Spanish is not what I speak so

Explanation:

You might be interested in
Give an example of a non-testable question:
Charra [1.4K]

Answer:

a non testable question can be, what is better, chips or ice cream?

Explanation:

8 0
3 years ago
Which two species are more closely related: Ursus maritimus, ursus americanus or bufo americanus
GarryVolchara [31]
I think that is bufo americanus.
5 0
3 years ago
Read 2 more answers
the trait for flower color is highly variable among certain species of rose plants leading to the formation of flowers of differ
ioda

Does it have options?

6 0
3 years ago
In an experiment, what is the factor that is tested? control specimen hypothesis variable
e-lub [12.9K]

The factor being tested is the variable. There are two types of variables, independent and dependent. The independent variable is the factor being changed by the scientist or the person controlling the experiment. The dependent variable is the thing that gets changed due to the changing of the independent variable. The dependent variable cannot be changed physically by the person doing the experiment.

6 0
3 years ago
How does salinity change with temperature?
Katarina [22]

How does salinity change with temperature ?

<h3> C. as water warms, it contracts and becomes less salty ✓ ...</h3>

  • Increases in temperatures of surrounding entities like ice and an increase in precipitation adds fresh water into the sea, which lower salinity ...

Hope this helps you :) ...

5 0
2 years ago
Other questions:
  • Which most closely defines niche? A. a role that a population has within its community B. a unique environment in which an organ
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which tool should be used to accurately measure 22.0 mL of a liquid
    13·2 answers
  • Discuss the three stages of interphase and the events which occur within each stage.
    9·1 answer
  • Why are there two sets of phases during meiosis, but only one during mitosis?
    10·1 answer
  • You're conducting an experiment to determine the effect of different wavelengths of light on the absorption of carbon dioxide as
    6·1 answer
  • Does acceleration have a direction?
    10·1 answer
  • How does the catalyst affect the energy curve ?
    13·1 answer
  • Why do I not get sick when I eat cheese with holes in it, but I do get sick when I eat chicken that has gone bad?
    10·1 answer
  • The general function of an enzyme in the body is to
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!