1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
13

Without the herbivores what would happen to the plant population

Biology
1 answer:
navik [9.2K]3 years ago
7 0
The plant population would grow out of control
You might be interested in
Tim wants to perform an experiment with yeast. He forms a hypothesis in which he predicts that all of the yeast will eventually
Olin [163]

Answer:

answer c

Explanation:

4 0
3 years ago
Someone help me asap!!!!
leva [86]

Answer:

1 and 3

Explanation:

If you look at it the same things they have are

Phylum - Chlordata

Class - Mammalim

Order - Carnirvora

Family - Felidae

Genus - Felis

(sorry if i spelt something wrong, i cant really read it that well)

5 0
2 years ago
Which best describes what is happening in the area marked y
Zigmanuir [339]

Answer:

Oxygen is being released through the Stomata

Option (A)

4 0
3 years ago
Read 2 more answers
Name and describe all of the weather fronts.
Yakvenalex [24]

Answer:

four different types of weather fronts: cold fronts, warm fronts, stationary fronts, and occluded fronts.

a air front is a weather system that is the boundary separating two different types of air. One type of air is usually denser than the other, with different temperatures and different levels of humidity.

A cold weather front is defined as the changeover region where a cold air mass is replacing a warmer air mass. Cold weather fronts usually move from northwest to southeast. ... Warm fronts usually move from southwest to northeast and the air behind a warm front is warmer and moister than the air ahead of it.

Stationary Front - a front between warm and cold air masses that is moving very slowly or not at all.

Occluded Front - a composite of two fronts, formed as a cold front overtakes a warm

pls mark brainliest

8 0
3 years ago
Read 2 more answers
What type of change alters the form or appearance of matter but does not turn any substance in the matter into a different subst
mestny [16]

Answer:

physical change alert the form of appearance of the matter but does not turn any substance in the matter into a different substance.

5 0
3 years ago
Other questions:
  • Neap tides, relatively weak tides, occur when the Moon is in position(s)
    10·2 answers
  • Blank inject DNA or RNA into the nucleus of a cell to reproduce
    7·2 answers
  • What ways can ions enter the ocean
    14·2 answers
  • During translation, the tRNA molecule carrying the correct amino acid corresponding to its anticodon sequence must base pair wit
    11·1 answer
  • After a search of nucleotide sequence databases, researchers identified an IRE in the 5c untranslated region of a gene encoding
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The proportions of a population that are at different age levels make up the population’s a. fertility rate. c. age structure. b
    9·1 answer
  • A hypothesis is a general principle or explanation that is derived from observations. Suppose you make the following observation
    11·1 answer
  • What effect does the increased temperature have on the ecology and distribution of plant species
    8·1 answer
  • This procedure for measuring cell size has certain limitations . List three such limitations​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!