Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
1. Humboldt
2. Mendocino
3. Sonama
4. Butte
5.Santa Clara + Alameda + San Mateo + Santa Cruz (according to thr map I found there were 4)
6. San Luis Obispo + Santa Barbara (2)
7. Orange + San Diego (2)
Answer:
uuiuuuuuijhj until j um internationalization
Answer:
Parasites are organisms that infect the body of another living being and live off their hosts to survive. While some parasites create no symptoms in their hosts, others can cause severe illness. Parasitic infections occur when parasites grow, reproduce, or invade organ systems that make their hosts ill.
