1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
7

Which causes movement in mass wasting

Geography
1 answer:
Dmitry_Shevchenko [17]3 years ago
4 0

Answer:

Mass wasting, which is sometimes called mass movement or slope movement, is defined as the large movement of rock, soil and debris downward due to the force of gravity. ... The causes of mass wasting include an increased slope steepness, increased water, decreased vegetation and earthquakes.

Explanation:

You might be interested in
Identify ONE stream/river variable.
babunello [35]

Answer: what u mean heres a river tho  nile river also known as the nile, hope this helps you a little bit.

Explanation:

8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
The big bang theory has finally answered one of the biggest questions of science—the origin of the universe.
Nookie1986 [14]
A. True.............
8 0
3 years ago
Help me fast please!!!!!!!!!
Nutka1998 [239]

Answer: D. changes direction

Explanation: A lens works by refraction: it bends light rays as they pass through it so they change direction.

Hope this helps

4 0
3 years ago
Horizontal moves occur along plate margins
masha68 [24]
? I don’t understand the question?
8 0
3 years ago
Other questions:
  • The name of the ancient supercontinent _____ means "all lands" or "all Earth."
    9·2 answers
  • Can someone please help me?<br><br> There is a picture and I will mark a brainliest! Thanks :)
    12·1 answer
  • Based on the physical features you see on this map, why do you think the timber and logging industry is located where it is?
    15·2 answers
  • What is the ring of fire?
    12·1 answer
  • Africa is often termed “___________________” because of the examples of advanced development found by archeologists.
    14·2 answers
  • Which sustainable agricultural practice involves tilling and planting on ridges that are across or perpendicular to a slope? A.
    14·1 answer
  • Why might a river that was eroding and depositing sediment along its sides start to cut into Earth to form a canyon?
    7·1 answer
  • History of lower Egypt?
    12·2 answers
  • What amount of Earth is covered by oceans?​
    11·2 answers
  • Why is eastern region climate milder than Western region climate of Nepal​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!