Answer:
It is about 30 percent more
Explanation:
Global Warming is the reason for the change in the amount of carbon dioxide in the air from 200 years ago. Alaska has been warming nearly twice as quick as the global scale. Alaska in the past few years has been recording some of its warmest temperatures, with a new marking of snow records in various places.
Answer:
while the Earth rotates it revolves around the sun which dosent move. while this is happening the moon is revolving around the earth
The five key features of tornadoes are formation, speed, vacuums, location and dust devils. They usually form in large thunder clouds. Their internal winds begin to whirl forming a funnel. The speed at which the funnel spins can be 400 km/hr making them the fastest winds on earth. The funnel acts like a giant vacuum sucking up debris and dirt as it goes. They usually only last about 15 minutes but can cover over hundreds of kilometers in that time. The primary location of tornadoes is in the United States in the Mid-Western states. If it develops over sea it is called a waterspout with winds up to 80 kph. In deserts where there is not as much water, small sandstorms known as dust devils are produced by whirling winds.
Major Key Fact: A tornado will sound like a roaring train. It is a deafening roar.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
During the summer solstice or for dates right now it is June 21
