1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
3 years ago
15

Assuming the human genome is 3×109 bp and that the average insert size in the genomic libraries is 100 kb, how frequently will a

clone representing myostatin be found in the genomic library made from muscle?
Biology
1 answer:
SashulF [63]3 years ago
3 0
<span>A clone representing myostatin would be found in the genomic library made from muscle approximately one time out of every sixty thousand. Under the given conditions, the human genome and average insert size, the frequency of that particular type of clone can be estimated to be very near the probability of 1/60,000. This can be expressed either in fraction form or in descriptive words and maintain the same level of meaning.</span>
You might be interested in
There is no sound in the vacuum of space. Why?
aleksandr82 [10.1K]
In the vacuum of space there is no molecules. Sound waves get to your ears by bouncing off of molecules in the air. No molecules in space's vacuum means sound waves have nothing to bounce of off so they can not reach our ears meaning we hear no sound.
4 0
3 years ago
The heavier the object the _____________________ _____________________ it has if it has the same velocity at all masses.
iren2701 [21]

Answer:

C) More momentum

Explanation:

The heavier the object the more momentum it has if it has the same Velocity at all masses.

5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
feeling pain, hunger, thirst, sleepiness, and being aware of our thoughts and emotions are all examples of ________ stimuli.
zepelin [54]

Feeling pain, hunger, thirst, sleepiness, and being aware of our thoughts and emotions are all examples of Internal stimuli.

3 0
3 years ago
Which of the following statements are true regarding cellular reproduction? Select all that apply.
atroni [7]
Replacing dead cells
3 0
3 years ago
Read 2 more answers
Other questions:
  • A person's mental and emotional condition can have no effects on their overall health.
    11·1 answer
  • The "essential nutrients" for proper human nutrition include _____. the "essential nutrients" for proper human nutrition include
    11·1 answer
  • Many clinicians diagnose disorders by using criteria listed in the
    10·1 answer
  • Which level of biodiversity involves variations within a single population?
    5·2 answers
  • In a pedigree, an open circle represents a
    15·1 answer
  • 2. Describe sexual reproduction.
    6·2 answers
  • How do you tell if the pedigree is recissive ordominant? By the wa the cirlces and squares with all da lines andscribbles are sh
    12·1 answer
  • Which of the following is NOT characteristic of those who engage in coercive or aggressive sexual activity?
    6·1 answer
  • How does natural selection lead to the development of antibiotic resistance?
    7·2 answers
  • During the t wave of the electrocardiogram, the ventricles are electrically ________ and functionally ________
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!