1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
netineya [11]
3 years ago
11

A person who is homozygous for tnf-alpha (+/+) has which phenotype

Biology
1 answer:
padilas [110]3 years ago
3 0

They produce normal TNF-alpha protein

You might be interested in
Question 1 of 10 Which type of thermal energy transfer warms your hand when you hold it near a glass of hot water? O A. Radiatio
horrorfan [7]
B convention oooooolookooo
5 0
3 years ago
Helpppoppppp please
Mrac [35]

Answer:

rly just move the boxes click on them than click and hold and drag across the board or click on it and hit <--backspace

Explanation:

3 0
3 years ago
What have the dry gardens (like the one above) been interpreted to represent? a. the path to enlightenment b. volume through sha
horsena [70]

Answer:

b. volume through shading and perspective

Explanation:

What have the dry gardens (like the one above) been interpreted to represent volume through shading and perspective

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
You would MOST LIKELY find a savannah grassland biome in an area with
Travka [436]

Answer:

D

Explanation:

8 0
2 years ago
Read 2 more answers
Other questions:
  • What does a ribosome do?
    5·2 answers
  • 11. By what process do streams and rivers move material?
    5·2 answers
  • How does diabetes affect the blood flow in the cardiovascular system
    9·1 answer
  • Which is a major difference between the cell membrane and the cell wall? A-Cell membranes are living; cell walls are not living.
    12·1 answer
  • The physical laws that govern Earth’s systems involve _____. the biosphere and atmosphere matter and energy temperature and prec
    8·2 answers
  • Caudal paralysis, as a consequence of injury to the spinal cord from an injured back, occurs commonly in which species? select o
    6·1 answer
  • Climatologists and meteorologist both use data to make predictions related to climate and weather. Which statement best indicate
    11·1 answer
  • a botanist scrapes pollen off a flower of one plant and then uses it to pollinate the flower of another plant. what can be scien
    9·2 answers
  • What explains a child's growth over time?
    7·2 answers
  • What is ONE way in which geologists may utilize GPS and satellite mapping?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!