1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
3 years ago
10

What are some of the challenges scientists most overcome when studying extreme environments such as deep space or the deep ocean

?
Biology
1 answer:
kvv77 [185]3 years ago
7 0

Let us look at the what, why and how of studying extreme places like the deep earth and the deep space. Scientists need to figure out as to 'what' they want to look at such places, be it a new exotic creature or bio-genesis (birth of life). Unless there are several testable hypothesis constructed, such a study cannot begin. The 'why' aspect deals with the purpose of such research and expeditions. Is it of any use to the humans, or will it improve our current understanding of a phenomenon? The 'how' aspect deals with the technology and the economic assistance that can help in undertaking such a research. All these are the challenges that needed to be thoroughly considered to make such a research or expedition possible.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Explain the process of formation of complex proteins ​
mart [117]
Proteins in a protein complex are linked by non - covalent protein - protein interactions. The process of complex formation comprises of steps namely : ... An encounter complex is formed that either proceeds towards final complex or dissociates again.
3 0
2 years ago
Which practice is used to destroy and eliminate<br> all threats in the microbial world?
hichkok12 [17]
Sterilization controls the microbial in this world
5 0
2 years ago
Kevin decides to find out which fertilizer is best for tomatoes. He set up three plants, giving one no fertilizer, giving the se
sergejj [24]

Answer:

No, it has too many variables or possible changes.

Explanation:

If you carried out an experiment or research on something, you have to given the same environmental and soil conditions to the factors. In this experiment, Kevin put the first plant in large pot and the other two plants in the field conditions. For performing correct experiments, Kevin put all the plants in separate pots or in the field conditions.

6 0
3 years ago
What kind of neuron is used in 3 types of gasses
avanturin [10]
Sensory" Neuron
  "Associative Neuron"
  "Motor" Neuron
5 0
3 years ago
Other questions:
  • Volcanic belts form along a. islands in the Pacific Ocean. b. North American mountain ranges. c. the boundaries of Earth’s plate
    9·2 answers
  • Do organisms within a population compete to survive
    14·1 answer
  • How many days are in 22 weeks
    12·2 answers
  • Natural selection is the primary mechanism of
    8·1 answer
  • PLSSSA HELPPP !!!! Why does the author include this paragraph in the
    8·2 answers
  • What does it mean to reduce? Give examples.
    6·2 answers
  • There is an overwhelming amount of evidence supporting evolution by natural selection. This evidence can be divided in several c
    5·1 answer
  • PLS!!!!!!!!HELP!!!!!!!
    10·1 answer
  • The sun is the ______ source of energy for hetertrophs
    14·1 answer
  • A stronger force can cause a greater change in velocity.<br> O True<br> O False
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!