1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STatiana [176]
3 years ago
12

In the 1960s, new evidence helped support the theory of continental drift and change it into the theory of plate tectonics. What

was this new evidence?
Biology
2 answers:
mrs_skeptik [129]3 years ago
8 0
They found fossils and rocks that did not fit the climate they should have ben found in.
Misha Larkins [42]3 years ago
8 0

Answer:

the dinosaurs lived long ago and they died and know there bones are every where

Explanation:

You might be interested in
What is Newton's third law of motion
aleksklad [387]

Answer:

His third law states that for every action (force) in nature there is an equal and opposite reaction.

Explanation:

7 0
3 years ago
What is the function of the flower stalk
BigorU [14]
The main function of the flower stock is transporting food in the form of water and nutrients to different parts of the plant with the help of xylem and phloem. Xylem helps in transporting cells that help in carrying water and minerals from the roots while phloem transports food in the form of sugar to all parts of the plant. The stock also helps in keeping the the flower steady above the plant folliage. This directly helps in the process of pollination of the plant. The flower that is held steady above the folliage attracts bees and other insects through which it continues the process of pollination.
3 0
3 years ago
a pea plant with round seeds is cross with a pea with wrinkled seeds. what can you conclude about the wrinkled seeds? (a, b, c,
vagabundo [1.1K]
A. The wrinkle shape is a recessive trait.
6 0
3 years ago
Read 2 more answers
The main function of the small intestine is nutrient absorption. Which of the following structural qualities of the intestine in
Bogdan [553]

Answer:

The correct answer will be option a and b.

Explanation:

The food is digested and absorbed in the small intestine, a long folded tube which lengths about 20 ft or 6m.  

The small intestine increases the surface area for food absorption as they have circular folding as well as the finger-like projections called villi and microvilli in the lumen of the intestine. These villi help in absorption of the nutrients from the intestine.

Thus, option a and b are the correct options.

7 0
3 years ago
Help please! brainliest and 10 points!
ValentinkaMS [17]

Answer: Food groups were coded by stripes in widths corresponding to the recommended servings from each group. All the stripes tapered toward the top of the pyramid to remind people that each food group includes both healthy and unhealthy choices, such as foods with added sugar or “solid” fat.

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • How many deciliters are in 8.12 decaliters?
    8·2 answers
  • Which term describes the way an organism responds to stimuli?
    6·2 answers
  • Would this be the answer??
    12·1 answer
  • A nonnative squirrel is introduced into a forest. Which would most likely prevent this squirrel from becoming an invasive specie
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following can lower the carrying capacity of a particular area?
    13·1 answer
  • Many people die whilst they are waiting for an organ transplant. Why is this?
    7·1 answer
  • Please help this will help me pass high school I just need this one answer please will like it
    15·1 answer
  • 17. The ff. are true of ligands
    8·1 answer
  • Write a brief report on bacteria and fermented milk products.​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!