1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
2 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]2 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
How and why has the air quality changed in the United States over the last 30 years?
Mars2501 [29]

Answer:

It has gotten worse.

Explanation:

In the past 30 years, air quality in the United States has declined almost exponentially. Pollution is the main reason for the declination of air quality in the United States, but there are different kinds of pollution, including light pollution, noise pollution, air pollution, water pollution, etc. Air pollution can be caused by primary or secondary pollutants. Primary pollutants include carbon, nitrogen, and sulfur oxides as well as just general particles in the air. Secondary pollutants are formed when pollutants are exposed to sunlight via chemical reactions.

6 0
3 years ago
You find a rock with fossils in it.is this rock more likely to be a sedimentary rock than an igneous rock?explain
noname [10]
Yes because igneous rocks are made from lava that cools in or outside of a volcano and sedimentary rocks are simply made of sand rocks and other things that just stick together in layers and forms a rock. I don't know if I'm being clear though... Sorry I speak French but I hope I helped :)
4 0
3 years ago
Read 2 more answers
The male reproductive parts of a flower are called
gulaghasi [49]
The correct answer in this question is letter B. The male reproductive parts of a flower are called stamens. It is composed of an anther and a filament. The pollen, which is located in the anther, contains the male reproductive cells.
7 0
3 years ago
What are earthquakes?
hichkok12 [17]
An earthquake is the perceptible shaking of the surface of the Earth, resulting from the sudden release of energy in the Earth's crust that creates seismic waves.
5 0
3 years ago
How do organisms within the population share and compete for things they need to survive?
frutty [35]
Organisms compete for the resources they need to survive- air, water, food, and space. In areas where these are sufficient, organisms live in comfortable co-existence, and in areas where resources are abundant, the ecosystem boasts high species richness.
6 0
3 years ago
Other questions:
  • Frances puts a hungry rat into an experimental chamber. whenever the rat presses a lever, food falls into a tray. in about 30 mi
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Explain why a pregnant woman should avoid drinking alcohol
    14·1 answer
  • Gustatory and olfactory refer to which of the following senses, in which order?
    15·2 answers
  • The Milky Way galaxy was given its name because of what it looks like when viewed from Earth.
    11·1 answer
  • Cual crees que es la ventaja de la organización social en los animales
    11·1 answer
  • Please help me quick<br> Does anyone have the answers to the unit 4 Genetics unit test in biology.
    11·1 answer
  • 32 POINTS!!
    8·1 answer
  • Tại sao lá cây có màu xanh
    7·1 answer
  • a tracheostomy may be indicated for which injury? a. laryngeal injury b. bronchial injury c. esophageal injury d. diaphragmatic
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!