1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
2 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]2 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
What virus can infects only cats
anastassius [24]

Answer:

Feline Immunodeficiency Virus

Explanation:

8 0
3 years ago
Is nitrogen base part of a molecule of DNA​
natima [27]

Answer:

nitrogenous base, yes

Explanation:

5 0
3 years ago
Read 2 more answers
The extraocular muscles and the muscles of mastication are a part of the
telo118 [61]
Face Muscle

Reasoning- Right by the Jaw of the face where the muscles of mastication is.
3 0
2 years ago
Read 2 more answers
Cofactors for some enzymes are not considered prosthetic groups because they are loosely held during the course of reaction.A. T
kotykmax [81]

Answer:

True

Explanation:

Cofactor is a biological term used in describing a form of a non-protein chemical compound. It is highly required in the biological operation. It is in two types, the Coenzymes and Prosthetic groups.

While the Prosthetic groups are well connected to an enzyme, the coenzymes on the other hand are conected to an enzyme loosely.

Hence, it is TRUE that Cofactors for some enzymes are not considered prosthetic groups because they are loosely held during the course of the action

4 0
3 years ago
n the Pleistocene period 10,000 years ago, there was a remarkable extinction of vertebrates in many continents, which may explai
sleet_krkn [62]
Whaaattttttttttt HURRRRRYYY

3 0
2 years ago
Other questions:
  • Which statement about entropy is not true
    13·2 answers
  • Identify which scientist or group of scientists was responsible for making each of the following discoveries. The double-helix s
    6·2 answers
  • Which of the following situation would a state government address
    5·1 answer
  • Gross production is the amount of energy left after cellular respiration true or false ?
    5·2 answers
  • Bioinformatics can
    13·1 answer
  • Which sequence accurately portrays the chronological order in which hominids evolved?. A. Homo habilis, Homo erectus, Australopi
    13·2 answers
  • 4 The state of matter with a fixed
    5·2 answers
  • BRIEFLY EXPLAIN what you would say is the difference between XXX SYNDROME AND XYY SYNDROME.
    6·1 answer
  • What’s the another name for the sweet liquid of a plant
    11·2 answers
  • Help...
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!