1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]3 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
What parts of the world are deserts located???
MA_775_DIABLO [31]
Dry and arid parts of the world with little to no rain.
5 0
4 years ago
What happens to a watershed if it rains
hram777 [196]

Answer:eh water could either be drained into the soil or land on plants to become dew

Explanation:i searched up what a watershed was lol

3 0
4 years ago
What is the microscopic anatomical make-up of skeletal muscles?
larisa [96]

Answer:

Muscles at the microscopic level are made of actin (thin filament) and myosin (thick filament) fibers in alternation and parallel to each other.  During contraction, the fibres seem to slip against each other in opposite directions. Technically, the myosin head ‘walks’ on the actin – in an engage and release motion – with the help of ATP. Several actin and myosin fibers make up a myofibril. Each contractile unit in the myofibril is called a sarcomere – viewed as Z-discs at the microscopic level.

8 0
4 years ago
what would happen if polutry birds are larger in size and have no summer adaptation capacity? in order to get small sized polutr
olga_2 [115]
That is right u should give him brainliest
6 0
4 years ago
Grass -> Grasshopper -> Mouse-> Hawk
andrey2020 [161]

Answer:

B

Explanation:

7 0
3 years ago
Other questions:
  • Silicate rocks are weathered by______ into clay minerals
    6·1 answer
  • Is it possible to move in a curved path in the absence of a force?
    10·1 answer
  • Two tectonic plates of different densities collide. Which of the following could form at the plate boundary
    6·2 answers
  • Which technology do environmental scientists use to track the health of the amazon rain forest
    6·1 answer
  • Where do the microtubules of the spindle originate during mitosis in both plant and animal cells?
    10·2 answers
  • I need a writing prompt make it opinion and school appropriate. 7-11 gradw
    10·2 answers
  • After the zygote is formed and cells become more specialized what process begins?
    12·1 answer
  • In the kool aid mixture, what must there be more of, hydrogen ions or hydroxide ions?
    5·1 answer
  • Add the corresponding RNA base pairs to make a mRNA strand given the following DNA segment. (1)
    15·1 answer
  • A vaccine is a substance that contains a harmless version of a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!