The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m
olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Adenosine 5'-triphosphate, or ATP, is the most abundant energy carrier molecule in cells. This molecule is made of a nitrogen base (adenine), a ribose sugar, and three phosphate groups. The word adenosine refers to the adenine plus the ribose sugar.
