The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

Question

2 years ago

6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Biology

1 answer:

balu736 [363] · Answer 1 · 2022-07-25T15:36:26+03:00

balu736 [363]2 years ago

3 0

Dge78wdgqwe8fguefuqefioequf9be