1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]3 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
Region with depth up approximately 200 m
kotykmax [81]
<span>Region with depth up approximately 200 m

that would be the abyssal zone

hope this helps

</span>
8 0
3 years ago
Describe how the three different types of seismic waves move and affect the movement of the material they pass over or through.
son4ous [18]
Seismic waves travel in all the directions and used to determine the magnitude of an earthquake. There are 3 types of seismic waves that move in different directions.
1. P wave: It is the fastest of all three waves that travel through the interior of the earth and are compressive waves.
2. S wave: Secondary waves generally follow the P waves and travel through the interior of the earth but are shearing waves.
3. Surface wave: This is the slowest of all three waves that moves close to the surface of the ground.

These waves affect the movement of other materials when they are passing through the interior or surface of the earth.
P waves can move through the solid rocks and even liquids. S waves do not travel through the  liquids such as water and molten magma. Surface waves causes shaking of the ground and do not go deep inside the earth.
7 0
3 years ago
A full explaination of osmosis. Please I need it fast​
Pie

Osmosis is the movement of a solvent across a semipermeable membrane toward a higher concentration of solute (lower concentration of solvent). ... When a cell is submerged in water, the water molecules pass through the cell membrane from an area of low solute concentration to high solute concentration.

8 0
3 years ago
Read 2 more answers
Shontae was diagnosed with PTSD following her return from a tour in Afghanistan. Due to her repeated nightmares and flashbacks a
ASHA 777 [7]
Antidepressants and prazosin maybe?
7 0
3 years ago
Look at the body shapes of the fish shown below.
sergey [27]

The correct answer is option B

The fishes that live in the shallow water along the sea floor needs a flattened shape and eyes on the dorsal side because they need to see above and have least possibility that the eyes will be required to see downwards as they lie at the sea floor.

They have tail for protection and flattened body for easy swimming.

Example: Stingray.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Where are methanogens found
    8·1 answer
  • Bruce believes that male students in his physics course spend more time working on homework than female students. His teacher an
    5·2 answers
  • Stress has an effect on every system of the body. Please select the best answer from the choices provided. T F
    8·1 answer
  • As the human population increases, which problem is technology least likely to be able to solve?
    12·1 answer
  • which offspring could not arise from the parent cells with the chromosomes shown below? Assume crossovers can occur between chro
    14·2 answers
  • Please select the word from the list that best fits the definition
    12·2 answers
  • Biology may be defined as the ______ of ________ according to your lesson. o.o
    9·1 answer
  • How does folding dough help it to rise
    10·1 answer
  • True or False:
    9·2 answers
  • In angiosperm double fertilization, one sperm nucleus fertilizes the ______ to form the diploid ______, and a second sperm nucle
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!