1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]3 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
How do chlorofluorocarbons contribute to the hole in the ozone layer
Westkost [7]

Answer:

Ozone layer saves the earth from the ultraviolet rays of sun which is harmful for earth. It is situated jn upper atmosphere and saves earth. But thus chlorofluorocarbons destroys the Ozone Layer in the atmosphere.

7 0
3 years ago
Which type of cell division only occurs in organisms whose cells contain chromosomes?
Lelechka [254]
<span>Mitosis is the cell division that happens in all cells in the human body except sperm and egg cells. They produce diploid cells. While meiosis on the other hand is responsible for the cell division of the gametes, spermatogenesis (sperm cells) and oogenesis (egg cells), such haploid cells. </span>
5 0
3 years ago
In what way is the nervous system comparable to electricity?
ICE Princess25 [194]
It carries signals for the body through nerves (answer 3)
8 0
3 years ago
This thermogram shows a person using a computer. Complete the sentence to describe the flow of thermal energy between the person
Nostrana [21]

Answer:

The thermal energy will flow from the computer to the person.

Explanation :

Usually computer are such devices which converts electrical energy into thermal energy and then it gets transferred to the person. The energy flows from the higher amount to lower amount. In this case, computer is producing higher thermal energy than the person that’s the reason for the flow of energy from computer to the person.

3 0
3 years ago
Read 2 more answers
Based on your observations, which way does earth rotate—from east to west, or west to east? Explain your answer.
JulijaS [17]

Based on my observations, the earth rotates from west to east about the axis of rotation. The counter-clockwise rotation of the earth is as viewed from the North Pole star Polaris.

My observations supporting the counter-clockwise rotation of the earth are:

  • The Sun rises in the east and sets in the west.
  • All celestial objects including the stars and the moon rise in the east and set in the west.

The rotation is the result of the strong geomagnetic field of the earth. It is also responsible for the formation of day and night on the planet.

Learn more about the Rotation of the earth:

brainly.com/question/24246687

6 0
1 year ago
Other questions:
  • Which of the following is not a method by which antibiotics attempt to kill bactería?
    7·1 answer
  • What happens with insecticides and herbicides that we put on our lawns?
    6·2 answers
  • A client is to undergo surgery to repair a ruptured Achilles tendon and application of a brace. The client demonstrates understa
    6·1 answer
  • The idea that chromosomes orient themeselves randomly during metaphase I is ________________________. This leads to ____________
    13·1 answer
  • The United States was responsible for the Human Genome Project (HGP). True False
    8·2 answers
  • How to invasive plants effect negatively and how does removing them effect is positively
    11·1 answer
  • Describe the difference between a food chain and a food web.(1 point)
    7·1 answer
  • What type of relationship do a deer and tick have?<br> Explain the relationship. ?
    7·1 answer
  • Which label belongs in the area marked "Y"? may change the type of amino acid decreases the number of bases in the sequence neve
    5·2 answers
  • Why is it important to have a standard set of units amongst all scientists?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!