1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]3 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
Can anyone please help me?
Ksenya-84 [330]

Answer:

D

Explanation:

4 0
3 years ago
Read 2 more answers
Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?
Greeley [361]

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

8 0
2 years ago
What is one way that micro organisms can be harmful to humans?
puteri [66]

Microbes cause infectious diseases such as flu and measles.

https://microbiologyonline.org/about-microbiology/microbes-and-the-human-body/microbes-and-disease

7 0
3 years ago
Read 2 more answers
Which of the following statements about natural selection is true:
ss7ja [257]

Answer:

Option 2 (Population of organisms change over time.

6 0
3 years ago
10 POINTS!!! (CHOOSE FROM MINE!)
Elina [12.6K]

Answer:

a weather data are misinterpreted

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not released by trees into the atmosphere?
    10·1 answer
  • What is the difference between incomplete dominance, codominance, polygenic inheritance, and multiple alleles? give an example o
    13·1 answer
  • What is cardiorespiratory endurance?
    8·2 answers
  • Which label is appropriate for the party appealing a case?
    11·1 answer
  • The tendency to make correct judgments in detecting the presence of stimuli is called __________.
    7·1 answer
  • At which stage of this food chain will there be the smallest number of organisms
    10·2 answers
  • Help! I need help with this ASAP, I'm so confused for this.
    9·1 answer
  • 16. Which type of sediments would be most common where a river meets an ocean?
    12·1 answer
  • What causes stomach cramps?​
    13·2 answers
  • Which of the following is a Decomposer?A. TreeB. FishC. WormD. Hawk
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!