1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]3 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
3. Which of the following elevations is represented by an index contour<br> line?
algol13
Haikyuu is thehonest so D I guess
5 0
3 years ago
Read 2 more answers
a scientist designs an experiment to test the effect of fertilizer on the height of sugar cane. two fields are fertilized and tw
myrzilka [38]

An experiment is created by a scientist to determine how fertiliser affects sugar cane height. Two fields receive fertilization, but the remaining two do not. Fertilizer Application serves as the experiment's control group.

Fertilizer Application is typically limited to irrigated plantations and varies by region and even by farmer. Fertilizers will work best if used between 12 and 24 months before and after the peak growing season. One year after planting, farmers typically spray 50 kg of urea and 50-100 kg of DAP per acre. Since Casuarina manufactures its own nitrogen with the aid of the bacterium Frankia, it does not require a significant amount of nitrogen fertiliser. In order to prevent this, it is advised to apply 11 kg of urea and 94 kg of superphosphate at moderate level.

Learn more about Fertilizer Application here

brainly.com/question/28217230

#SPJ4

5 0
1 year ago
6) When DNA is copied, sometimes a new, incorrect, base pairing appears within the structure of a new DNA molecule replacing ori
Jet001 [13]
It's D. Substitution
8 0
3 years ago
Read 2 more answers
Why do living organism need energy
zaharov [31]

they need energy because there cells need to reproduce  

8 0
3 years ago
What fermentation takes place in animals
prisoha [69]
Lactic acid fermentation
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which are units used to express volume
    7·1 answer
  • What happens when an object in space moves towards us?
    6·1 answer
  • Question 13.
    14·1 answer
  • The wide variety of color observed in a coral bed is due to the presence of bacteria
    7·2 answers
  • 1. All animals except sponges have , groups of cells that work together to perform a specific function. 2. All animals eat other
    11·1 answer
  • Write a 5-sentence paragraph to explain how energy and work are related. Give an example of that.
    11·1 answer
  • Often organisms seem similar in their outward appearances. For example, a porpoise and a shark seem closely related, but they ar
    9·1 answer
  • What organelle is a neuron cell missing, if it can't divide, and how does this help it perform its function? ​
    9·1 answer
  • How does the hurricane decrease in<br> strength/intensity?
    11·2 answers
  • Which of the following materials would not normally be found in glomerular filtrate?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!