1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]3 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
Science is not a process, but just a body of facts that<br> accumulates overtime.<br> TRUE<br> FALSE
IRINA_888 [86]

Answer:

False

Explanation:

Science is more about gaining knowledge than it is about simply having knowledge. Science is a way of learning about the natural world that is based on evidence and logic. In other words, science is a process, not just a body of facts. Through the process of science, our knowledge of the world advances.

7 0
3 years ago
The wall of the alveolus (air sac) in the lung is composed of which type of epithelium?
lesantik [10]
Psuedostratified columnar epithelium
5 0
4 years ago
All volcanoes have at least one vent, or opening. Which of the following does not erupt through volcanic vents?
Lelu [443]
B.Liquid Water
Explanation: lava gushes out ashes go up and gases when it erupts only water does not erupt.
5 0
3 years ago
Sally was exposed to hepatitis. Her doctor gave her an injection containing
expeople1 [14]

Answer:

The correct answer is - passive immunity - artificially acquired.

Explanation:

Passive immunity is the immunity that involves giving or acquiring antibodies from other sources instead of developing them on one's own. This type of immunity can be natural and artificial. Mother breastfeed the babies, is the natural passive immunity example as milk also contain antibodies required for immunity of babies.

Artificial passive immunity is the immunity that comes from injecting the antibodies created in different animals or persons which called antiserum or vaccines such as snake antivenom.

5 0
3 years ago
Rainforests around the world are being cleared at an alarming rate to make room for new communities, agriculture, mining, and ro
Kamila [148]

Answer:

(1) by increasing carbon dioxide and decreases oxygen

6 0
3 years ago
Other questions:
  • Describe ways in which a healthy artery differs from an artery affected by coronary heart disease
    9·1 answer
  • Meiosis produces what type of cell?
    10·2 answers
  • En las clínicas radiológicas existen letreros/ avisos que indican que las mujeres embarazadas o sospechan estarlo, antes de some
    8·1 answer
  • A. You are performing experiments with your protein of interest and its ligand. You are attempting to mutate the binding site of
    10·1 answer
  • Which best compares DNA and RNA with regard to the process of protein production?
    8·2 answers
  • Cell walls of the kingdom plantae is made of what?
    15·2 answers
  • The Hawaiian silversword originated from a species of tarweed, which is a plant native to present-day California. This plant col
    10·1 answer
  • Which type of bond joins the COOH group of one molecule to the NH2 of another molecule? A. 1-4 Glycosidic bond B. Ester bond C.
    15·1 answer
  • A ball falls off a building which has a height of 100 meters. It hits the
    7·1 answer
  • each chromosome originally is made of how many DNA molecules and how does this molecule appear in the chromosome
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!