1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
6

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna m

olecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
Biology
1 answer:
balu736 [363]3 years ago
3 0
Dge78wdgqwe8fguefuqefioequf9be
You might be interested in
Does succession happen to a plant or a forest?
swat32
Succession is a thing that happens to forests or other ecosystem landscapes.
7 0
3 years ago
Which of the following is a way of storing carbon in organic material?
Xelga [282]
A way of storing carbon in organic material is Burning fossil fuels or D all of these
3 0
3 years ago
Match the description to the form of water that is described.
GaryK [48]

Answer:

Molecules are attracted to each other, but not ordered: liquid water

ater vapor

Molecules are not stuck together: water vapor

Liquid water Molecules are joined in an ordered structure: ice

Explanation:

8 0
3 years ago
A researcher examined the response of dandelions to herbivory by rabbits. She finds that in a greenhouse with no rabbits, there
vazorg [7]

Answer:

b.

Explanation:

Based on the information provided within the question it can be said that from this info the researcher can conclude that Dandelion seed number is a constitutive defensive response to rabbit herbivory. This is mainly due to the fact that Dandelions that have been eaten by the rabbits have produced more seeds, meaning that the Dandelions defense mechanism produces more seeds when attacked in order to prevent the flower's extinction.

4 0
3 years ago
Which substance is not absorbed by the body when using snuff?
Eduardwww [97]
The correct answer is Tar
7 0
4 years ago
Read 2 more answers
Other questions:
  • What is meant by the phrase "plants are green factories"?
    9·2 answers
  • f pink snapdragons of the F1 hybrids (RW) are crossed with red snapdragons of the parent plant (RR), what will be the ratio of f
    14·1 answer
  • Since cognitive therapy focuses on changing thoughts rather than gaining deep insights into their causes, this kind of therapy i
    15·2 answers
  • this type of connective tissue in the central nervous system is a star shaped cell that anchors small blood vessels to neurons
    6·1 answer
  • ) the two boxers battled toe-to-toe until the final round, when the longtime champion of the ring was finally ______ by his youn
    7·1 answer
  • What is the function of the part that is labeled A?
    10·2 answers
  • Why does blood flow faster in arteries
    8·1 answer
  • If you were working for a pharmaceutical company as part of a drug discovery team, which of these enzyme inhibitors would you su
    13·1 answer
  • A group of three letters on DNA is called?
    8·1 answer
  • Ai weiwei created a series of photographs of himself dropping a 2,000-year-old object. What was it?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!