1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
USPshnik [31]
3 years ago
6

How does ground water become polluted ?

Biology
2 answers:
Flauer [41]3 years ago
4 0

Answer:

The groundwater becomes polluted when the pollutants get mixed with water and pass through the permeable layers above the aquifer.  

One of the most essential sources of water for irrigation is groundwater. Unfortunately, groundwater is vulnerable to pollutants. The contamination of groundwater takes place when man-made components like oil, gasoline, chemicals, and road salts get into the groundwater and make it unfit for human consumption.  

Read more on Brainly.com - brainly.com/question/10091854#readmore

Explanation:

AlladinOne [14]3 years ago
4 0

Answer:

its just A

Explanation:

You might be interested in
Who discovered the monomers of nucleic acids?
Valentin [98]

Answer:

Phoebus Levene

Explanation:

im took the exam

5 0
3 years ago
Read 2 more answers
Can small carbon compounds be formed into large carbon compounds?
Sphinxa [80]

Answer:

ya it can also be the largest compound but it needs alot if pressure

6 0
3 years ago
Read 2 more answers
What are the 3 functions of mitosis
sineoko [7]

the three functions of mitosis are Asexual Reproduction, growth, and tissue repair.

5 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Why do cells tend to have more ADP molecules than ATP molecules
LenKa [72]

The reason why the cells have more ADP than ATP molecules is that the cells have the tendency to use more ATP, rather than restore ADP molecules.

When the body produces energy, in order to be able for it to be released in the body and to be used by the body, the ATP molecules break up. During that break up of the ATP molecule it actually loses one phosphate group, thus becoming an ADP molecule. Since this process is going on constantly, the ATP molecules are constantly breaking up thus resulting in constant new ADP molecules, so they are easily becoming outnumbered.

8 0
3 years ago
Other questions:
  • What circumstances must be present for enormous balls of hail to grow and then fall to the ground?
    6·1 answer
  • The atom of an element has six protons and eight neutrons. The number of electrons in this atom is neutral is
    8·1 answer
  • How many legs does a daddy long legs have?
    7·2 answers
  • Nuclear power plants produce power by ?<br> ________
    12·2 answers
  • Asexual reproduction results in greater reproductive success than does sexual reproduction when _____.
    9·1 answer
  • 1. View the cartoon below. Describe how this cartoon illustrates interphase.
    5·1 answer
  • when consuelo struck a tuning fork and held it close to a string on a guitar the string began to vibrate on its own and make a s
    15·1 answer
  • What type of cells can be found in both multicellular and single celled organisms
    12·2 answers
  • Question 5 of 9
    7·2 answers
  • Alaltion
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!