Ask question

Ask question

All categories

3 years ago

8

What is the odd one out atoms and cells

1 answer:

Harlamova29_29 [7]3 years ago

7 0

Atoms because in biology we don't study about atoms

You might be interested in

A possible result of pumping large amounts of water from an underground aquifer is that

kap26 [50]

Wells in an area might run dry

7 0

3 years ago

Read 2 more answers

As a mouse undergoes respiration, it produces lactate. This type of respiration can be classified as

Juli2301 [7.4K]

would it be acidic? since it produces lactic acid

4 0

4 years ago

A. The trait for the disease is recessive, and each offspring had a 50% chance of receiving the recessive allele and developing

max2010maxim [7]

The answer to this question is the second option

6 0

3 years ago

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

Ierofanga [76]

<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

6 0

4 years ago

Juan designed an experiment to test what effect different substances would have on the freezing point of water. To test this, he

s344n2d4d5 [400]

Ignore this_____________

4 0

3 years ago