1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
muminat
3 years ago
12

I need help but fast

Biology
1 answer:
Olegator [25]3 years ago
5 0
The answer to your question should be the second option
You might be interested in
HURRY PLEASE TWENTY POINTS
yawa3891 [41]
DNA is being used as a template to make a molecule of mRNA.
8 0
3 years ago
Transcribe the following DNA sequence to make mRNA molecule <br><br>GGAATGAGAATTC
GenaCL600 [577]
CCUUACUCUUAAG is the mRNA sequence
5 0
3 years ago
Read 2 more answers
URGENT
hram777 [196]
(B it breaks down carbon- base sugar molecules to release energy and forms carbon dioxide
3 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Using the drop-down menus below, identify the processes cells use to maintain homeostasis
IRISSAK [1]

Answer:

  • Osmosis
  • Active Transport
  • Passive Transport
  • Diffusion

Explanation:

3 0
3 years ago
Other questions:
  • Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell
    16·2 answers
  • 1. What muscle is directly beneath the biceps?
    13·1 answer
  • Which best describes meiosis?
    16·2 answers
  • Can bees detect bombs? True or false.
    7·1 answer
  • One of the factors that increases body heat during adaptive thermogenesis is the production of ___________ by skeletal muscle. t
    14·1 answer
  • Which shot angle rarely results in a clean kill, ruins a lot of meat, and provides an animal the best opportunity to detect the
    6·1 answer
  • Match the protozoa to the descriptions of how each one travels.
    12·2 answers
  • The form in which the chemical energy is stored in cells during photosynthesis is?
    15·1 answer
  • Smooth muscle _____.
    13·2 answers
  • 3. Decomposers are organisms that obtain energy by breaking down dead matter and recycling the nutrients back into the soil. Dec
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!