1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
3 years ago
5

A tree grows and increases its mass explain why it is not a violation of the law of conservation of mass

Biology
1 answer:
gregori [183]3 years ago
4 0
A tree is not an isolated system. It gets nutrients from surrounding environment to grow and build its mass. A total mass of tree plus its environment is constant. 
You might be interested in
Which statement best explains why the atmosphere is considered an open system?
katovenus [111]
The answer is B

An open system has its energy and matter leave and enter the system's boundaries unlike in a closed system where energy remains within the system.
The earth's atmosphere shares heat and water vapor with the hydrosphere (oceans, seas and lakes), energy form the sun, in the atmosphere and then partly radiated back to space
5 0
3 years ago
Read 2 more answers
What is the ''great geological cycle''
bekas [8.4K]
 The continuous process in which hot, molten material coming to the surface of the Earth from the interior forms igneous rocks, which are then broken down by weathering to create soil and sedimentary rocks.

4 0
3 years ago
Read 2 more answers
What two types of evidence do we use to study inside Earth?
FromTheMoon [43]
A. Direct evidence
Hope that helps you out
7 0
3 years ago
Read 2 more answers
14. A heart attack may be due to all of the following except
soldi70 [24.7K]

Answer:

1) an increase in arterial blood pressure

Explanation:

Blood pressure is not an accurate predictor of a heart attack. Sometimes a heart attack can cause an increase or decrease in blood pressure, but having a change in blood pressure reading doesn't always mean it's heart-related.

5 0
3 years ago
Read 2 more answers
What kind of plate boundary results in a fault?
Bumek [7]
a transform boundary because the two plates pass each other in that same plane and the blocks of rock move in opposite horizontal directions .
6 0
4 years ago
Read 2 more answers
Other questions:
  • During which period did humans first appear on Earth? Quaternary Neogene Paleogene Cenozoic
    10·2 answers
  • The process in which the violent shaking of an earthquake that turns soft soil into liquid mud
    5·2 answers
  • In which process does water move from the land to the air?
    12·2 answers
  • What is the function of proteins and carbohydrates that are embedded in a cell membrane?
    9·2 answers
  • Your skeletal stores calcium. How does the calcium get into your body
    7·1 answer
  • What is one result of Meiosis?
    13·2 answers
  • Materials with small, connected pores are a. impermeable c. unsaturated b. permeable d. saturated
    6·2 answers
  • Which of the atoms below has the lowest atomic mass?​
    14·1 answer
  • i am so bored like my Gf don't want to get on idk why and i was watching you tube and twitch on my favorite people and was just
    6·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!