1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uranmaximum [27]
3 years ago
12

Which of the following is not a constructive force on earth?

Geography
1 answer:
Alex73 [517]3 years ago
8 0

Erosion, cause it causes only negative consequences

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
A. Globalization<br> B. Internet technology<br> C. Telecommunications technology<br> D. Treaties
Gekata [30.6K]
I think it is A due to globalization, less people need to make products in there own country.
7 0
3 years ago
PLLLLLZ HELP 15 POINTS The magnetic pattern of ocean-floor rocks on one side of an ocean ridge is ____.
iren2701 [21]
Either the first one or second one
4 0
3 years ago
What is often the result of earthquakes in the middle of the Pacific Ocean?
erica [24]

Answer:

Tsunamis are formed by earthquakes and the disturbance in the middle of the Pacific Ocean. Fortunately, most of the time, they do not reach land.

6 0
3 years ago
Create your own infographic of the information presented on this page.
Lunna [17]

Answer:

An infographic is a graphic visual representation of data, or information intended to present an information quickly and clearly.

Explanation:

It can be done on canva

Steps:

1. Choose your desired infographic template.

2.Identify the audience for your infographic.

3.Collect your content and relevant data.

4.Download your template to PowerPoint.

5.Customize your infographic.

6.Include a footer with your sources and logo.

7.Add an embed code and Pinterest button, and publish it.

4 0
2 years ago
Other questions:
  • What volcano in greece, with an elevation of 367 m, has been worthy of study as a result of its explosive history and close prox
    9·2 answers
  • 30% of the earths surface is made up of? <br> A. Water <br> B. desert <br> C. land<br> D. cities
    6·1 answer
  • True or False: Tourism has helped the economics in the Caribbean Islands but has also had negative effects.
    11·1 answer
  • What is the geological history of hulunbuir grassland?
    7·1 answer
  • How much sulphur and carbon dioxide does a volcanic eruption of Kilauea typically emit?Select one: a. 45,000 tons per day (equal
    11·1 answer
  • How does subsistence agriculture differ from market-oriented agriculture?
    9·1 answer
  • The map below shows the locations of what type of boundary?
    14·1 answer
  • PLEASE HELP !!!! Which of the following statements regarding development in sub-Saharan Africa is true? A. No country in sub-Sah
    15·2 answers
  • Tại sao bán cầu Nam lại mưa nhiều hơn bán cầu Bắc?
    6·1 answer
  • What is not an accurate statement about the fossil record?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!