1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
damaskus [11]
3 years ago
8

State what enzymes are made of

Biology
2 answers:
dusya [7]3 years ago
7 0
They are made of long chains of different amino acids
creativ13 [48]3 years ago
4 0
Enzymes are large molecules that speed up the chemical reactions inside cells. Each type of enzyme does on specific job. Enzymes are a type of protein, and like all proteins<span>, they are made from long chains of different </span>amino acids<span>.</span>
You might be interested in
Can i get the answers?
aivan3 [116]

Explanation:

<h3>This is Your Anwer ⬇⬇</h3>

<h3>1. Activation energy, in chemistry, the</h3><h3> minimum amount of energy that is required to activate atoms or molecules to a condition in which they can undergo chemical transformation or physical transport.</h3>

<h3>• True or False </h3>

<h3>1. False </h3><h3>2. True</h3><h3>3. True </h3>

<h3 /><h3 /><h3>Q 2.</h3><h3 /><h3>• Left figure is</h3><h3 /><h3> : Endothermic Reaction </h3><h3 /><h3>Endothermic reaction : In an endothermic reaction, the products are higher in energy than the reactants.</h3><h3 /><h3 /><h3>• Right Figure </h3><h3 /><h3>Exothermic reaction: In an exothermic </h3><h3>reaction, the total energy of the products is less than the total energy of the reactants.</h3>
5 0
3 years ago
Read 2 more answers
What is the life cycle of the silk worm
Lady bird [3.3K]
They first start out as an egg. After they hatch, the become a larva. Then they turn into a pupa. After that a developing moth, and finally an adult.

That’s the life of a silkworm.

Hope this helps and hope you have a great day and brainiest is always appreciated.
7 0
4 years ago
Explain what happened genetically in the insect population.
Alekssandra [29.7K]

as insects became exposed to pyrethroids, toxicity of pyrethroids weakened over time. which means that Most insects had the allele for pyrethroid resistance, but it remained masked. The allele for said pyrethroid resistance, evidently increased throughout the population.

has this helped?

5 0
3 years ago
Which of the following monomers would be used to make the double helix of a DNA molecule?
V125BC [204]

Answer:

The correct answer is the first option which represent the structure of a nucleotide.

Explanation:

DNA double is formed by the attachment of deoxy ribonucleotides joined to one another by phosphodiester bond during the course of DNA replication.

   DNA is a nucleic acid.As a result it is a macromolecule.The macromolecular structure of DNA consist of numerous deoxy ribonucleotides.

5 0
4 years ago
Which properties of water plays an important role in the movement of water from the roots to the leaves in plants?
lesya [120]
Which properties of water plays an important role in the movement of water from the roots to the leaves in plants? Is <span>capillary action</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • 3. What was the role of the water test tube in each phase
    12·2 answers
  • In Cats , the ellele for short hair is dominant. Show the cross for a purebread short haired cat and a purebread long hair cat.
    15·1 answer
  • Panic grass (Dichanthelium lanuginosum) can live in geothermally heated soils only when the fungus Curvularia protuberata is pre
    15·1 answer
  • Extensive use of advanced technology is one way to contain costs in the medical field. true or false?
    7·2 answers
  • During a presentation about evolution a student claims that modern giraffes inherited their long necks from ancestral giraffes t
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Which homeostatic process requires energy to move particles across the plasma membrane?
    9·2 answers
  • A mitotic cdk-cyclin complex __________. a mitotic cdk-cyclin complex __________. triggers entry into mitosis stabilizes the nuc
    14·1 answer
  • PLEASE HELP BIG POINT
    7·2 answers
  • Which of the following will be the most similar?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!